2023 Volume 34 Issue 5

Temperature-controlled fabrication of hydrophilic manganese oxide microspheres as high-performance electrode materials for supercapacitors
Yuchen Wang , Yaoyu Liu , Ahsan Ejaz , Kai Yan
2023, 34(5): 107538  doi: 10.1016/j.cclet.2022.05.052
[Abstract](3141) [FullText HTML] [PDF 2754KB](11)
Abstract:
The supercapacitive properties of manganese oxides (MnOx) are strongly affected by their crystal structure. Nevertheless, the relationship between the crystal structure and supercapacitive performance of MnOx is elusive. Herein, a temperature-controlled fabrication method was developed to achieve MnO2, Mn3O4, MnO and Mn2O3 microspheres with various crystal structure as electrode materials tunable for supercapacitors. The detailed material and electrochemical characterizations revealed the structure-activity relationship of MnOx microspheres by systematically investigating the effect of valence state, specific surface area, conductivity and morphology on supercapacitive performance. Among these MnOx materials, nanoneedle-like MnO2 delivered a relatively high specific capacitance of 274.1 F/g at 1 A/g due to a high Mn valence state of +4, a large specific surface area of 113.4 m2/g and a desirable electronic conductivity of 1.73 × 10–5 S/cm. Furthermore, MnO2 presented a remarkable cycle stability with 115% capacitance retention after 10,000 cycles owing to the enhancement of wettability. This work not only provides a facile strategy to modulate MnOx crystal structure, but also offers a deep understanding of structure-dependent supercapacitive performance of MnOx.
Revealing milling durations and sintering temperatures on conductivity and battery performances of Li2.25Zr0.75Fe0.25Cl6 electrolyte
Shuai Chen , Chuang Yu , Chaochao Wei , Linfeng Peng , Shijie Cheng , Jia Xie
2023, 34(5): 107544  doi: 10.1016/j.cclet.2022.05.058
[Abstract](2959) [FullText HTML] [PDF 3739KB](11)
Abstract:
Halide electrolytes in solid-state batteries with excellent oxidative stability and high ionic conductivity have been well reported recently. However, the high-cost rare-earth elements and long duration of high-rotation milling procure are the major obstacles. Herein, we have successfully synthesized the low cost Li2.25Zr0.75Fe0.25Cl6 electrolyte consisting of abundant elements with comparable Li-ion conductivity in a short milling duration of 4 h. Phase transition of the annealed sample was also carefully investigated. LiNi0.6Co0.2Mn0.2O2/Li2.25Zr0.75Fe0.25Cl6/Li5.5PS4.5Cl1.5/In-Li batteries using different halide electrolytes were constructed and cycled at different voltage windows. Solid-state battery using Li2.25Zr0.75Fe0.25Cl6 electrolyte obtained from long milling duration delivers higher discharge capacities and superior capacity retention than shorter milling time between 3.0 and 4.3 V. It delivers much higher discharge capacity when cycled at elevated temperature (60 ℃) and suffers fast capacity degradation when the upper cut-off voltage increases to 4.5 V at the same current density. This work provides an efficiency synthesis strategy for halide solid electrolyte and studies its applications in all-solid-state batteries in a wide temperature range.
V-substituted pyrochlore-type polyantimonic acid for highly enhanced lithium-ion storage
Haoyu Fang , Kai Yong , Boya Wang , Kaipeng Wu , Yun Zhang , Hao Wu
2023, 34(5): 107545  doi: 10.1016/j.cclet.2022.05.059
[Abstract](2581) [FullText HTML] [PDF 6093KB](8)
Abstract:
Pyrochlore-structured polyantimonic acid (PAA) is a potential high-capacity electrode material, but its innately poor electroconductivity (~10−10 S/cm) seriously impairs its electrochemical reversibility for lithium-ion storage. Herein, we report design and synthesis of a novel V-substituted PAA (PAA-V), where V5+ are introduced to partially replace Sb5+. Owing to identical valence and close ionic radius relative to Sb5+, the V5+ cation can constitute the covalent VO6 octahedra framework without changing the pyrochlore crystal structure of PAA. As a result, the V5+-substitution is capable to modulate the electronic structure of PAA with significantly improved electrical conductivity (~10−6 S/cm for PAA-V) and meanwhile decreases the size of crystals with reduced diffusion length for Li+-ions. With varying the ratio of V5+-substitution, the PAA-V with optimized substitution molar ratio (18%) exhibits the best lithium-ion storage performance, delivering a long cycling life with high reversible capacity (731 mAh/g after 1200 cycles at 1 A/g) and outstanding rate capability (279 mAh/g at 15 A/g). More importantly, by pairing the PAA-V as anode and commercial LiFePO4 as cathode, the full cell with a limited negative/positive capacity ratio of 1.2 exhibits decent cycling stability at 1 C after 150 cycles with 85.5% capacity retention.
Multifunctional robust aerogel separator towards high-temperature, large-rate, long-cycle lithium-ion batteries
Mei-Chen Liu , Hui-Jun Chen , Gang Wu , Xiu-Li Wang , Yu-Zhong Wang
2023, 34(5): 107546  doi: 10.1016/j.cclet.2022.05.060
[Abstract](3259) [FullText HTML] [PDF 3262KB](10)
Abstract:
Separators is indispensable for the normal operation of lithium-ion batteries (LIBs). However, the widely used commercial polyolefin separators have some inherent deficiencies such as poor thermotolerance, high inflammability and inferior electrolyte wettability, which restrict their further applications of the advanced and safe batteries. Herein, we design a novel thermotolerant (a shrinkage percentage of 0% at 300 ℃) and flame retarded aerogel separator consisting of aramid nanofibers (ANFs). Because of its high porosity (86.5% ± 6.1%) and excellent electrolyte uptake (695%), the ANFs aerogel separator has an ionic conductivity of 1.04 mS/cm and a high lithium-ion transference number (0.67), which can endow LIBs with outstanding rate performance and superior cycling performance. Specifically, the ANFs aerogel separator-based batteries possess a discharge specific capacity of 102 mAh/g with a capacity retention of 90.7% and a Coulombic efficiency of 99.3% after 600 cycles at 5 C. In addition, under an operated temperature of 90 ℃, the battery with ANFs aerogel separator can still conduct the very steady charge-discharge, presenting a capacity retention of 90.1% and a Coulombic efficiency of 99.6% after 200 cycles at 3 C. Accordingly, the separator can probably serve as a potential candidate for application to advanced and safe LIBs.
Switching the coordination geometry to enhance erbium(Ⅲ) single-molecule magnets
Qian-Cheng Luo , Ning Ge , Yuan-Qi Zhai , Tengbo Wang , Lin Sun , Qi Sun , Fanni Li , Zhendong Fu , Yan-Zhen Zheng
2023, 34(5): 107547  doi: 10.1016/j.cclet.2022.05.061
[Abstract](1820) [FullText HTML] [PDF 927KB](5)
Abstract:
Two erbium(Ⅲ) complexes [ErCl(OArAd)3][Na(THF)6] (1) and Er(OArAd)3 (2) are successfully prepared by using one variety of "hard" base ligand with large steric hindrance. The coordination geometry around the Er(Ⅲ) site changes from distorted tetrahedral to flat trigonal pyramid geometry in different solvent environment due to the removal of the coordinated chloride. Such an alternation significantly enhances the single-molecule magnet (SMM) behavior and makes the field-induced effective energy barrier (Ueff) arrive at 43(1) cm−1 for the latter. Together with theoretical calculations, this study shows that strong equatorial ligand field and high local symmetry are critical to suppress the quantum tunneling of the magnetization (QTM) and achieve high-performance erbium(Ⅲ) based SMMs.
PIC catalysis based on polyoxometalates promoting 5-HMF oxidation in H2O/MIBK biphase
Qiwen Wang , Wenwen Bu , Zonghang Li , Yu Qi , Xiaohong Wang
2023, 34(5): 107548  doi: 10.1016/j.cclet.2022.05.062
[Abstract](1986) [FullText HTML] [PDF 2365KB](6)
Abstract:
Novel polyoxometalate (POM) Pickering interfacial catalyst (PIC) was fabricated through loading (NH4)5H6PMo4V8O40 (PMo4V8) on both alkyl and alkyl-amino groups functionalized silica nanoparticles. PMo4V8/SiO2(C8/C8NH2 with molar ratio as 1:1) PIC system provided a new catalytic model for aerobic conversion of 5-hydroxymethylfurfural (5-HMF), as well as its recovery and product separation in H2O/methyl isobutyl ketone (MIBK) biphase reaction. Balancing the ratio of PMo4V8, C8 and C8NH2 gave rise to variety in hydrophilicity and hydrophobicity for PMo4V8/SiO2(C8/C8NH2), which enhanced the transformation of 5-HMF to 2, 5-diformylfuran (DFF) in H2O/MIBK with 73.7% yield at 81.8% conversion than in H2O or MIBK single phase.
Pressure-stabilized hexagonal perovskite-related isolated tetrahedral anion silicate La6Sr3Si6O24
Jie Feng , Lei Zhao , Wenda Zhang , Cheng Li , Congling Yin , Xiaojun Kuang
2023, 34(5): 107551  doi: 10.1016/j.cclet.2022.05.065
[Abstract](2281) [FullText HTML] [PDF 1625KB](4)
Abstract:
The discovery of new perovskite compounds under high pressure mainly focuses on the ABO3 compositions and the compositions highly deviated from ABO3 are less explored. Here we demonstrate that the La6Sr3Si6O24 silicate composition can be stabilized as a hexagonal perovskite-related structure with isolated tetrahedra anions under high pressure of 6 GPa. The compound adopts 9-layer shifted hexagonal perovskite-like structure with both B-cation and oxygen deficiencies and contains pseudo-cubic (c′) (La/Sr)O2 layers and hexagonal (h) (La/Sr)O3 layers stacked according to (chh)3 sequence. This structure features both B-cation vacancy ordering between the two consecutive hexagonal layers and oxygen vacancy ordering in c′-(La/Sr)O2 layers, resulting in isolated tetrahedral SiO4 anions and ionic conduction behavior. This work demonstrates the practicability of accessing new perovskite-related functional materials from the compositions highly deviated from ABO3 under high pressure.
Bifunctional separator with high thermal stability and lithium dendrite inhibition toward high safety lithium-ion batteries
Miaomiao Su , Yifu Chen , Suqing Wang , Haihui Wang
2023, 34(5): 107553  doi: 10.1016/j.cclet.2022.05.067
[Abstract](3603) [FullText HTML] [PDF 2253KB](15)
Abstract:
Coating inorganic ceramic particles on commercial polyolefin separators has been considered as an effective strategy to improve thermostability of separator. However, the introduction of the coating layer could induce pore blockage on the surface of the polyolefin separator. Herein, a ceramic composite layer that consists of alumina nanoparticles (n-Al2O3) and halloysite nanotubes (HNTs) is designed to modify the polyethylene (PE) separator (the modified separator is denoted as AH-PE). The HNTs with hollow nanotubular structure construct a light skeleton and provide fast ion transport channels while Al2O3 particles function as heat-resistant fillers to inhibit the shrinkage of the separator at elevated temperatures. The total thickness of AH-PE separator is only 14 µm. Consequently, the mass increment of AH-PE separator decreases from 5 g/m2 to 3.5 g/m2, and the Gurley value reduces by 23%, compared with Al2O3 coated PE separator (A-PE). Due to the synergistic effects of Al2O3 and HNTs, AH-PE separator exhibits highly improved thermal stability (almost no shrinkage at 170 ℃ for 30 min), high Li+ transference number (up to 0.47), and long cycle life of 450 h for Li|Li cells. Moreover, the LiFePO4/Li cells assembled with AH-PE separators demonstrate improved rate capability and safety performance.
Frustrated Lewis pairs in situ formation in B-based porous aromatic frameworks for efficient o-phenylenediamine cyclization
Anqi Dai , Shulin Li , Tienan Wang , Yuting Yang , Yuyang Tian , Xiaofei Jing , Guangshan Zhu
2023, 34(5): 107559  doi: 10.1016/j.cclet.2022.05.073
[Abstract](3248) [FullText HTML] [PDF 1904KB](7)
Abstract:
Benzimidazoles are very important chemical materials in the pharmaceutical industry, and the most common synthetic route is cyclization of o-phenylenediamine with carbon sources, in which utilization of inexpensive and abundant CO2 as C1 source is very impressive. Porous aromatic frameworks (PAFs) with highly desired skeletons have attracted great attentions in gas capture and catalysis. Herein, B-based PAF-165 and PAF-166 are designed and synthesized via Friedel-Crafts alkylation reaction, which present high surface areas as well as high stability. Benefiting from the abundant electron-deficient B centers, both PAFs exhibit excellent selective CO2 adsorption abilities. The presence of sterically hindered B units in PAFs can act as Lewis acid active sites for the frustrated Lewis pairs (FLPs) in situ formation with o-phenylenediamine, thus promoting the synthesis of benzimidazole. The optimal reaction conditions for o-phenylenediamine cyclization with PAF catalysts are explored, and the reaction mechanism is also proposed. This work provides feasible ideas for incorporating FLPs within porous materials as reusable heterogeneous catalysts for CO2 capture and conversion.
In-situ electro-polymerization of l-tyrosine enables ultrafast, long cycle life for lithium metal battery
Zihao Chu , Sidong Zhuang , Jiahui Lu , Jiabao Li , Chengyin Wang , Tianyi Wang
2023, 34(5): 107563  doi: 10.1016/j.cclet.2022.05.077
[Abstract](2762) [FullText HTML] [PDF 5387KB](7)
Abstract:
The growth of dendrites in the lithium (Li) metal anode hinders the commercialization of lithium metal batteries (LMBs). Electrolyte additives have proved to be an effective way to solve the problem of dendrites and improve the coulombic efficiency. Herein, we propose a strategy of using l-tyrosine (l-Tyr) as an additive to protect the lithium metal anode in situ, where l-Tyr can be electropolymerized in situ to form an ordered array of nanosheets on the surface of the lithium metal anode to uniformly deposit lithium ions. At the same time, the addition of l-Tyr changed the structure of the solvent in the electrolyte, because the carboxyl group on l-Tyr make DME form hydrogen bonds easily. Besides, the reduction of free DME makes more TFSI involved in the formation of the SEI film on the electrode surface, which increases the proportion of LiF in the SEI film. With 2 wt% l-Tyr, Li||Li symmetric cells superior cycle stability in ether electrolytes, Li|Cu cells y improved stability up to 200 cycles with an average CE of 93.1% in ether electrolytes and Li||Li4Ti5O12 (LTO) demonstrated an excellent cycling capabilitie with 119 mAh/g capacity retention by the 5000th cycle.
Large negative thermal expansion in GdFe(CN)6 driven by unusual low-frequency modes
Qilong Gao , Yixin Jiao , Andrea Sanson , Erjun Liang , Qiang Sun
2023, 34(5): 107564  doi: 10.1016/j.cclet.2022.05.078
[Abstract](3350) [FullText HTML] [PDF 2707KB](11)
Abstract:
Understanding the negative thermal expansion (NTE) mechanism is of great importance. In this work, we consider the new NTE compound GdFe(CN)6 (αv = −34.2×10-6 K-1) as a case study to investigate the NTE mechanism from the perspective of the lattice vibrational dynamics. The atomic mean-square displacements suggest that the NTE of GdFe(CN)6 comes from the strong tension effect induced by the transverse vibrations of the atomic –Fe–C≡N–Gd– linkages, with the largest contribution given by N atoms. Lattice dynamics calculations show that three low-frequency optical modes at about 50 cm-1 show the largest negative Grüneisen parameters thus providing the largest contribution to the NTE. The existence of these unusual low-frequency vibrational modes can be ascribed to the presence of GdN6 trigonal prisms in the framework structure of GdFe(CN)6.
Electroreduction NO to NH3 over single metal atom anchored on pyrrole type defective graphene: A DFT study
Jiazhi Wang , Kai Li , Qi Hao , Dongxue Liu , Xinbo Zhang
2023, 34(5): 107567  doi: 10.1016/j.cclet.2022.05.081
[Abstract](2761) [FullText HTML] [PDF 2623KB](8)
Abstract:
Electrochemical is considered an attractive approach to recycling the pollution NO (NORR) and producing the valuable NH3, which could simultaneously solve the two challenging problems, i.e., NO removal and NH3 synthesis. Current research efforts focus less on NORR due to the lack of effective catalysts. Herein, based on DFT calculation, we try to explore effective pyrrole-type TM-N4 (TM = V, Cr, Mn, Fe, Co, Ni, Cu, Ru, Rh, Ta) catalysts for achieving the direct NORR. Among the investigated systems, Fe-N4 exhibits excellent catalytic activity and high NH3 selectivity. Moreover, the free energy of adsorption of N* has been proposed as a descriptor to predict and screen the effective TM-N4 catalyst for NORR and the crystal orbital halmilton populations (COHP) is used to describe the intrinsic relationship between metal atoms and the adsorption free energy of N* intermediate. This work has provided a theoretical picture of TM-N4 catalyzing NO to NH3, which will establish guidelines for the rational design of NORR catalysts and other electrochemical reactions.
A DFT study of two-dimensional P2Si monolayer modified by single transition metal (Sc-Cu) atoms for efficient electrocatalytic CO2 reduction
Chaozheng He , Houyong Yang , Xi Fu , Xiaoli Cheng , Jiyuan Guo , Ling Fu
2023, 34(5): 107579  doi: 10.1016/j.cclet.2022.06.002
[Abstract](3134) [FullText HTML] [PDF 2521KB](3)
Abstract:
In the present work, a stable two-dimensional (2D) P2Si monolayer was predicted. The monolayer is semimetallic/metallic under the PBE/HSE06 functional and is mechanically isotropic. The stability of the P2Si monolayer has been proved via cohesive energy, mechanical criteria, molecular dynamics simulation, and phonon dispersion respectively, and the monolayer possesses high carrier mobility which is three times that of MoS2. On the other hand, the catalytic performance of the P2Si monolayer modified with a single transition metals (M = Sc-Cu) atom for the electrochemical reduction of CO2 was investigated, and the monolayer can catalyze CO2 with three constraints: stable molecular dynamics, high migration potential of metal atoms, and suitable band gap for electrocatalyst after metal doping exhibiting excellent catalytic stabilization activity and CRR selectivity. In addition, the reduction product of V@P2Si is HCOOH with an overpotential as low as 0.75 V, and the most suitable reaction path is *CO2*CHOO → O*CHOH → * + HCOOH with the final reduction product HCOOH obtained. As a whole, the above results endow the P2Si monolayer to be a good 2D material holding great promises for applications in nanoelectronics and CO2 reduction catalysts.
Room-temperature synthesis of layered open framework cathode for sodium-ion batteries
Ruding Zhang , Huixin Chen , Hongjun Yue
2023, 34(5): 107580  doi: 10.1016/j.cclet.2022.06.003
[Abstract](2559) [FullText HTML] [PDF 3294KB](6)
Abstract:
The synthesis of active electrode materials at room temperature is one of the effective strategies to reduce the fabrication cost of sodium ion batteries (SIBs). Herein, a layered material (Na2[(VO)2(HPO4)2C2O4]·2H2O, abbreviated as NVPC followingly) with open-framework structures has been successfully prepared at room temperature under ambient conditions and is evaluated as a cathode for SIBs. It is revealed that NVPC cathode can deliver a maximum reversible capacity of ca. 70 mAh/g at 10 mA/g, and exhibit superior rate capability and cycling performance: at 50 mA/g, maximum reversible capacity ca. 50 mAh/g with capacity retention of 88.4% over 250 cycles corresponds to only 0.046% capacity decay per cycle; at 100 mA/g, a maximum reversible capacity of 35 mAh/g with capacity retention of 60.9% over 500 cycles. This study demonstrates a practical example of a low-cost synthesis of the cathode materials for SIBs. At the same time, the systematic electrochemical research results also show promising prospects for long lifespan low-cost SIBs.
A promising controllable CO2 capture and separation materials for CO2/CH4/H2 under electric field
Chaozheng He , Houyong Yang , Ling Fu
2023, 34(5): 107581  doi: 10.1016/j.cclet.2022.06.004
[Abstract](3067) [FullText HTML] [PDF 2276KB](6)
Abstract:
As the greenhouse effect concerns increases, the development of new materials for the efficient capture and separation of CO2 gas from gas mixtures has become a matter of urgency. In this study, we performed density functional theory (DFT) calculations to investigate the adsorption and separation behavior of CO2/CH4/H2 on the surface of two-dimensional (2D) Al2C materials under positive/negative applied electric fields. In the absence of an electric field CO2 is weakly physisorbed on the Al2C surface, but with the application of an applied electric field, the adsorption state of CO2 gradually changes from physical to chemisorption (adsorption energy changes from −0.29 eV to −3.61 eV), while the negative electric field has little effect on the adsorption of CO2. We conclude that the C=O bond in adsorbed CO2 can be activated under an external electric field (maximum activation of 15% under an external electric field of 0–0.005 a.u.). Only in the presence of an applied electric field of 0.0033 a.u. and temperatures above 525 K/675 K can the adsorption/separation reaction of CO2 single adsorption and CO2/CH4/H2 mixture be spontaneous. The adsorption/desorption of CO2 on Al2C nanosheet in an electric field of 0.003–0.0033 a.u. is all exothermic, which can be easily controlled by switching on/off the electric field without any energy barriers. The capacity of Al2C to capture CO2 per unit electric field decreases with increasing CO2 concentration, but still has efficient gas separation properties for CO2/CH4/H2. Our theoretical results could provide guidance for designing high-capacity and high-selectivity CO2 capture materials.
Heterogeneous photocatalytic borylation of aryl iodides mediated by isoreticular 2D covalent organic frameworks
Pengna Shang , Xiaoli Yan , Yang Li , Junji Liu , Guang Zhang , Long Chen
2023, 34(5): 107584  doi: 10.1016/j.cclet.2022.06.007
[Abstract](2539) [FullText HTML] [PDF 2086KB](9)
Abstract:
Metal-free heterogeneous photocatalysts provide an environmental-friendly and cost-efficient avenue for green organic synthesis. Covalent organic frameworks (COFs) as heterogeneous photocatalysts showcase promising potential in the field of photocatalytic organic reactions due to their high porosity, insolubility and tailor-made functions. However, thus far, COF-based catalysts only mediated a few types of reactions. Herein, we developed a series of isoreticular nitrogen-rich covalent organic frameworks (N-COFs) with comparable porous structures as photocatalysts which effectively mediated the borylation of aryl iodides with broad substrate scope. Remarkably, 6N-COF exhibits excellent photocatalytic efficiency and superior recyclability. It suggests a new pathway to construct efficient heterogeneous photocatalysts for the borylation of aryl halides.
Charge state modulation on boron site by carbon and nitrogen localized bonding microenvironment for two-electron electrocatalytic H2O2 production
Tingting Zhang , Yin Wang , Xiangyang Li , Quan Zhuang , Zixuan Zhang , Hong Zhou , Qin Ding , Yingqi Wang , Yuxin Dang , Limei Duan , Jinghai Liu
2023, 34(5): 107596  doi: 10.1016/j.cclet.2022.06.019
[Abstract](3615) [FullText HTML] [PDF 4456KB](6)
Abstract:
Design of electrochemical active boron (B) site at solid materials to understand the relationships between the localized structure, charge state at the B site and electrocatalytic activity plays a crucial role in boosting the green electrochemical synthesis of hydrogen peroxide (H2O2) via two-electron oxygen reduction (2eORR) pathway. Herein, we demonstrate a carbon (C) and nitrogen (N) localized bonding microenvironment to modulate the charge state of B site at the boron-carbon nitride solid (BCNs) to realize the efficient selective electrocatalytic H2O2 production. The localized chemical structure of N-B-N, N-B-C and C-B-C bonds at B site can be regulated through solid-state reaction between boron nitride (BN) and porous carbon (C) at variable temperatures. The optimized BCN-1100 achieves an outstanding H2O2 selectivity of 89% and electron transfer number of 2.2 (at 0.55 V vs. RHE), with the production of 10.55 mmol/L during 2.5 h and the catalytic stability duration for 15000 cycles. Further first-principles calculations identified the dependency of localized bonding microenvironment on the OOH* adsorption energies and relevant charge states at the boron site. The localized structure of B site with BNC2-Gr configuration is predicted to be the highest 2eORR activity.
CoS2/N, S co-doped mesoporous carbon with 3D micro-nano crosslinked structure as efficient bifunctional oxygen electrocatalysts for zinc-air batteries
Wei Wang , Liqin Li , Jie Ouyang , Jialin Gong , Jie Tian , Liang Chen , Junlin Huang , Binhong He , Zhaohui Hou
2023, 34(5): 107597  doi: 10.1016/j.cclet.2022.06.020
[Abstract](3019) [FullText HTML] [PDF 3785KB](4)
Abstract:
This work describes a bifunctional oxygen catalyst made of cobalt disulfide encapsulated in N, S co-doped mesoporous carbon with a novel three-dimensional micro-nano crosslinking structure. The proposed composite materials exhibit promising oxygen electrocatalytic activity and stability. The composite assembled rechargeable zinc-air battery can achieve a high power density of 208.9 mW/cm2, and can be stably cycled for more than 160 h. Additionally, the all-solid zinc-air battery assembled with the electrocatalyst also performs admirably. The micro-nano crosslinking and high porosity structure, as well as the large number of active sites generated by the synergy of N, S doping and the close interface between carbon matrix and CoS2, contribute to the composite's exceptional electrochemical performance. This study's rational strategy lays the path for the development of other high-performance bifunctional electrocatalysts.
Facile synthesis of defect-rich Fe-N-C hybrid from fullerene/ferrotetraphenylporphyrin as efficient oxygen reduction electrocatalyst for Zn-air battery
Hai Wang , Liyun Cao , Yongqiang Feng , Junsheng Chen , Weihang Feng , Tianmi Luo , Yuzhu Hu , Chengke Yuan , Yajuan Zhao , Yong Zhao , Koji Kajiyoshi , Yijun Liu , Zhenjiang Li , Jianfeng Huang
2023, 34(5): 107601  doi: 10.1016/j.cclet.2022.06.024
[Abstract](3247) [FullText HTML] [PDF 3938KB](8)
Abstract:
Exploring remarkable oxygen reduction reaction (ORR) electrocatalysts for regenerative fuel cells and metal-air batteries is highly essential. Herein, a novel non-noble metal-based heterogeneous electrocatalyst with rich defects were successfully synthesized by liquid-liquid interfacial precipitation (LLIP) of fullerene (C60) and ferrotetraphenylporphyrin (FeTPP) followed by one step pyrolysis. The obtained product annealed at 700 ℃ (C60/FeTPP-700), when employed as ORR electrocatalyst, revealed a positive half-wave potential (E1/2) of 0.877 V vs. reversible hydrogen electrode (RHE), which was superior to that of the commercial 25% Pt/C. Delightfully, the assembled Zn-air battery (ZAB) using C60/FeTPP-700 as an air-electrode catalyst exhibited a high power density of 153 mW/cm2, specific capacity of 668 mAh/g and long-term cycling stability for more than 250 h. Experimental results proved that the excellent electrocatalytic ORR activity of C60/FeTPP-700 would attribute to the synergistic effect between FeNx sites, Fe3C/Fe nanoparticles and the structure defects. This work provides a feasible and simple method to prepare non-noble metal-based ORR electrocatalysts for the application of energy storage and conversion.
Ultralong-life lithium metal batteries enabled by decorating robust hybrid interphases on 3D layered framworks
Qiongjie Ke , Qingshuai Xu , Xuejun Lai , Xianfeng Yang , Huichun Gao , Zaisheng Wang , Yongcai Qiu
2023, 34(5): 107602  doi: 10.1016/j.cclet.2022.06.025
[Abstract](2566) [FullText HTML] [PDF 5225KB](3)
Abstract:
Stable solid-electrolyte interphase (SEI) is crucial for advanced development of lithium metal batteries. However, the continuous collapse and reconstruction of SEI will deplete fresh Li and electrolytes upon cycling, leading to irreversible capacity loss. Herein, we addressed this issue by pre-formation of artificial robust hybrid interphase on a 3D layered graphene/lithium metal framework, in which is constructed by LiF associated with Li2TiF6 generated by the in-situ reaction between the surfacial lithium and titanium fluoride contained electrolytes. The as-obtained interphase can maintain the structure integrality and avoid continuous consumption of the fresh Li and electrolytes. As a consequence, the Li symmetric cells achieve high-efficiency Li deposition and stable cycling over 3600 h. When paired with LiFePO4 cathodes, the coin cells exhibit long lifespan (> 800 cycles) with almost 88.3% retention of the initial capacity.
Design and synthesis of liquid crystal copolyesters with high-frequency low dielectric loss and inherent flame retardancy
Shi-Yu Zhang , Teng Fu , Yue Gong , De-Ming Guo , Xiu-Li Wang , Yu-Zhong Wang
2023, 34(5): 107615  doi: 10.1016/j.cclet.2022.06.038
[Abstract](3413) [FullText HTML] [PDF 3007KB](12)
Abstract:
Ultra-low dielectric loss (Df) and low dielectric constant (Dk) materials are urgently required in high-speed and large-capacity transmission, in which the wholly aromatic liquid crystal polymer (LCP) has gained attention due to its excellent dielectric properties. However, the relationship between molecular structure and dielectric properties is still not clear. In this study, two copolyesters containing phenyl or naphthyl structures are synthesized, as well as the effects of benzene and naphthalene mesogens on dielectric properties are investigated. The synthesized copolyesters containing naphthalene structure have good comprehensive properties with high thermal stability (T5% = 479 ℃ and Tg = 195–216 ℃), inherent flame retardance (LOI = 33.0–35.0 and UL-94 V-0 level at 0.8 mm), low Dk (2.9–3.0@10 GHz) and low Df (0.0027–0.0047@10 GHz). Naphthalene mesogen can reduce the dielectric loss more significantly than benzene at high frequency by reducing the density and mobility of polarizable groups, which leads to the effectively limited dipole polarization in copolyesters. Consequently, we proposed a new strategy for designing low Dk and low Df materials.
Study on carbon matrix composite bipolar plates with balance of conductivity and flexural strength
Junsheng Zheng , Yuhang Peng , Runlin Fan , Jing Chen , Zize Zhan , Dongmei Yao , Pingwen Ming
2023, 34(5): 107616  doi: 10.1016/j.cclet.2022.06.039
[Abstract](3286) [FullText HTML] [PDF 2262KB](9)
Abstract:
In order to balance the conductivity and flexural strength of graphite composite bipolar plates, the influence of conductive filler on the properties of graphite composite bipolar plate was comprehensively studied by using phenolic resin as binder, natural flake graphite as conductive substrate and functional carbon materials with different structures as auxiliary filler. The results show that the particle size of conductive substrate has an important influence on the conductivity enhancement of auxiliary filler. The influence of conductive particle size on auxiliary filler electrical conductivity improvement was first investigated in this research. The effects of various auxiliary filler concentrations on improving electrical conductivity and flexural strength were then examined. This research has substantial implications for the balance of electrical conductivity and flexural strength of graphite composite bipolar plates.
Reducing obesity and inflammation in mice with organically-derivatized polyoxovanadate clusters
Kun Chen , Guoyong Dai , Shengqiu Liu , Yongge Wei
2023, 34(5): 107638  doi: 10.1016/j.cclet.2022.06.061
[Abstract](3205) [FullText HTML] [PDF 4434KB](3)
Abstract:
Obesity, characterized by the dysregulation of energy balance in adipose tissue and other metabolic organs, is frequently accompanied by chronic low-grade inflammation. As long-acting insulin sensitizers, the organically-derivatized polyoxovanadates (POVs), can extend the dosing interval of antidiabetic drugs from hourly to almost daily. In this work, the protective activity of POVs is investigated by an eight-week in vivo experiment, in which a small amount of POVs was administrated orally to a mouse model of diet-induced obesity every day. The present study shows that administration of POVs significantly decreases the body weight of mice, reduces adipose tissue accumulation, and simultaneously reduces adipose tissue inflammation. In addition, the anti-obesogenic population of iNKT cells is protected potentially by POVs, which subsequently alleviates visceral adipose tissue inflammation in high-fat-diet (HFD)-fed mice against diet-induced obesity. By contrast, the change in body weight after POV treatment is the result of a substantial reduction in fat mass, with no obvious effects on lean body mass. These findings demonstrate that supplementary of POVs would be an effective way to combat obesity and metabolic disorders while lowering metabolic inflammation.
Switchable nanoparticles complexing cisplatin for circumventing glutathione depletion in breast cancer chemotherapy
Ming Chen , Ying Xie , Qian Luo , Jiarui Xu , Yuxin Ren , Rui Liu , Huihui Zhao , Yuling Chen , Hexuan Feng , Yafei Du , Jianwei Li , Guiling Wang , Wanliang Lu
2023, 34(5): 107744  doi: 10.1016/j.cclet.2022.107744
[Abstract](2522) [FullText HTML] [PDF 4156KB](5)
Abstract:
Cisplatin is broad-spectrum chemotherapeutic agent that has been widely used for the treatment of a variety of malignant tumors including breast cancer. However, the cisplatin chemoresistance, which derives from the inactivation by glutathione (GSH) depletion, remains a scientific issue to solve. Here, we report a novel type of smart disulfide switchable nanoparticles complexing cisplatin (switch NPs-cisplatin) that is rationally designed, and engineered by synthesizing a hyaluronic acid disulfide bonded polyaspartic acid (HA-ss-Pasp) and complexing cisplatin. The results showed that the switch NPs-cisplatin had a nanoscale of particle size (150 nm), higher drug encapsulation efficiency (> 90%), and suitable drug release profile. They demonstrated evident pH responsiveness and GSH responsiveness, and targeting effect in the resistant breast cancer cells. Furthermore, they were able to block the cisplatin depletion by GSH in the resistant cancer cells, thereby circumventing the chemoresistance. Consequently, switch NPs-cisplatin displayed a remarkable killing effect in the resistant breast cancer cells in vitro, and in the resistant breast cancer-bearing mice. In conclusion, switch NPs-cisplatin could be used as a smart formulation of cisplatin for overcoming the chemoresistance of breast cancer. The present study also offers a universal drug delivery carrier platform for highly efficient but low systemic toxic chemotherapy.
Effectively arsenic(Ⅴ) and fluoride removal in geothermal water using magnetic Fe3O4@MgO nanoparticles
Qiangying Zhang , Xin Tan , Tao Yu
2023, 34(5): 107748  doi: 10.1016/j.cclet.2022.107748
[Abstract](2854) [FullText HTML] [PDF 4288KB](11)
Abstract:
High residual concentration of arsenic and fluoride is a tricky problem to be solved in the process of reinjection after geothermal water utilization. We develop a method to simultaneously remove As(Ⅴ) and F from geothermal water using magnetic Fe3O4@MgO adsorbent, fabricated via a one-step method. The effects of pH, contact time, adsorbent dose and temperature on the removal efficiency were investigated systematically. The results show that the Fe3O4@MgO composite has a wide range of pH (2–11), ultrafast removal dynamics (As(Ⅴ): 2 min; F: 30 min), and high removal efficiency (As(Ⅴ): 99.9%; F: 96.6%). The adsorption kinetics follows the pseudo-second-order kinetics model, and the adsorption isotherm model fits Freundlich. The adsorption capacity of As(Ⅴ) and F can reach 123 and 98.4 mg/g, respectively. The exchange of As(Ⅴ) and F with Mg-hydroxyl groups hydrolysis by MgO was determined the adsorption mechanism. The Fe3O4@MgO adsorbent was capable of achieving the adsorption efficiency as high as 99.9% for As(Ⅴ) and 97.3% for F in real geothermal water, respectively. Hence, the proposed Fe3O4@MgO composite exhibited as an excellent adsorbent for the remediation of As- and F-contaminated geothermal water.
Integrated and dual-responsive lipopeptide nanovector with parallel effect to tumor and micro-environment regulation by efficient gene and drug co-delivery
Xiaobing Chen , Huan Yang , Xu Song , Hong Liang , Yu Wei , Jiao Lu , Matthias Barz , Rongrong Jin , Yu Nie
2023, 34(5): 107753  doi: 10.1016/j.cclet.2022.107753
[Abstract](3358) [FullText HTML] [PDF 7649KB](6)
Abstract:
The integrated lipopeptide (RVA)/gene complexes are fabricated with bi-directional regulation on tumor cells and micro-environment. After self-assembling and target coating modification, the poly(γ-glutamic acid) (γ-PGA)/RVA nano-vectors can sequentially respond to pH & redox stimuli, and guarantee efficient therapeutic gene delivery and control release of all-trans retinoic acid. The design provides a facile but promising strategy to treat refractory cancers.
Coupling of sulfur and boron in carbonaceous material to strengthen persulfate activation for antibiotic degradation: Active sites, mechanism, and toxicity assessment
Feng Ye , Wei Sun , Kangfeng Pang , Wenchao Yang , Mengjie Pu , Qichun Zhang
2023, 34(5): 107755  doi: 10.1016/j.cclet.2022.107755
[Abstract](3190) [FullText HTML] [PDF 8397KB](7)
Abstract:
Carbon-mediated persulfate advanced oxidation processes (PS-AOPs) are appealing in contaminant remediation. For the first time, S,B-co-doped carbon-based persulfate activators were synthesized through direct carbonization of sodium lignosulfonate and boric acid. By degrading sulfamethoxazole (SMX), CSB-750 obtained 98.7% removal and 81.4% mineralization within 30 min. In comparison with solo S or B doping, S and B co-doped carbon showed the coupling effect for enhanced catalysis. The rate constant (kobs) of 0.1679 min–1 was 22.38- and 279.83-fold higher than those of CS-750 (0.0075 min–1) and CB-750 (0.0006 min–1), respectively. The degradation was efficient at strong acidic and weak basic conditions (pH 3–9). Substantial inhibition effect was presented at strong basic condition (pH 10.95) and in presence of CO32–. The CO32–-caused inhibition was the combined result of the cooperation of pH and quenching O2·–. Thiophene sulfur, BC3, BC2O, and structural defects were identified as the active sites for PS activation. Radical and nonradical pathways were both involved in the CSB-750/PS/SMX system, where 1O2 dominated the degradation, SO4·–, ·OH and direct electron transfer played the subordinate role, and O2·– served as a precursor for the formation of partial 1O2. The toxicity of degradation system, the effect of real water matrix, and the reusability of carbocatalysts were comprehensively analyzed. Nine possible degradation pathways were proposed. This work focuses on the catalytic performance improvement through the coupling effect of S, B co-doping, and develops an advanced heteroatom doping system to fabricate carbonaceous persulfate activators.
Design, synthesis, and evaluation of PD-L1 degraders to enhance T cell killing activity against melanoma
Yang Liu , Mengzhu Zheng , Zhilu Ma , Yirong Zhou , Junfeng Huo , Wenbo Zhang , Yu Liu , Yuanyuan Guo , Xuechen Zhou , Hua Li , Lixia Chen
2023, 34(5): 107762  doi: 10.1016/j.cclet.2022.107762
[Abstract](2784) [FullText HTML] [PDF 4247KB](28)
Abstract:
Inhibitor targeting immune checkpoint is a promising new anticancer therapy. Blocking the interaction between PD-1 and PD-L1 can reverse the immunosuppression state and improve the lethality of immune cells to tumor cells. Here, we report PROTAC-based PD-L1 degraders to enhance T cell killing activity against melanoma. Four series of PD-L1 degraders were designed and synthesized to VHL, CRBN, MDM2 or cIAP E3 ligase system, in which CRBN-ligand-based compound BMS-37-C3 was identified as the most active PROTAC molecule. BMS-37-C3 also significantly enhanced the killing ability of T cells in a co-culture model of A375 and T cells. Furthermore, western blot data and flow cytometry demonstrated that BMS-37-C3 could reduce the protein levels of PD-L1 in dose and time dependent manner, which may provide a new therapeutic method for tumor immunotherapy.
Fabrication of microwave-sensitized nanospheres of covalent organic framework with apatinib for tumor therapy
Qijun Du , Jian Zou , Zhongbing Huang , Shimei Li , Longfei Tan , Xiangling Ren , Guangfu Yin , Yongfa Zheng , Xianwei Meng
2023, 34(5): 107763  doi: 10.1016/j.cclet.2022.107763
[Abstract](3167) [FullText HTML] [PDF 5535KB](6)
Abstract:
A new nanocomposite of hollow covalent organic framework (COF) conjugated with the apatinib (AP) and loading microwave-sensitizer (ionic liquid, IL) was prepared by layer by layer (LBL) method and hyaluronic acid (HA) coating, named as COF-AP-IL@HA. AP loading rate in COF hollow-spheres (~30 nm shell thickness) was ~40.3%, due to the interactions of hydrogen and π-π bonds between AP and COF shell, and acidic environment destroyed COF structure, promoting AP release. Microwave sensitization of loaded IL in COF hollow-spheres could enhance the microwave heat-effect, and combined AP therapeutic ability, leading to their higher inhibitation on tumor, due to targeting ability of HA and the local release of apatinib. 88.9% of inhibition rate of COF-AP-IL@HA under microwave on the in vivo tumor was significantly higher than those without microwave (12.3%) and COF-IL@HA with microwave (37.5%), indicating a synergism of sensitized microwave hyperthermia and AP therapy on the reduced expression of VEGF via the downregulation pathway of hypoxia inducible factor. These results indicated that COF-AP-IL@HA was potential to the application in the combination therapy of tumor of the sensitized microwave hyperthermia and apatinib.
Highly specific selenium nanosystems for fluorescent image-guided rapid diagnosis and pathological grading of ovarian malignant tumors
Shaolie Zheng , Wei Huang , Nan Li , Yuan Shen , Xiaoyu Wang , Tianfeng Chen
2023, 34(5): 107764  doi: 10.1016/j.cclet.2022.107764
[Abstract](2411) [FullText HTML] [PDF 11894KB](2)
Abstract:
Comprehensive surgical staging or optimal tumor cytoreductive surgery of malignant ovarian cancer directly affects disease prognosis. Therefore, a fluorescent selenium nanoparticle (Se@RGD/S2.2) decorated with cancer-targeting Arg-Gly-Asp (RGD) peptides and GCAGTTGATCCTTTGGATACCCTGG aptamer (S2.2) was developed for use as a diagnostic agent to achieve rapid, noninvasive diagnosis and visualization of microinvasive lesions during surgery for malignant ovarian cancer.
Highly efficient electrocatalytic deuteration of acetylene to deuterated ethylene using deuterium oxide
Siyu Chang , Jun Bu , Jinjin Li , Jin Lin , Zhenpeng Liu , Wenxiu Ma , Jian Zhang
2023, 34(5): 107765  doi: 10.1016/j.cclet.2022.107765
[Abstract](2670) [FullText HTML] [PDF 2701KB](11)
Abstract:
Deuterated ethylene is an important building block for manufacturing various deuterated polyolefins and chemicals. However, low-cost and large-scale production of deuterated ethylene still remain a great challenge. Herein, with D2O as the D source, we first propose an electrocatalytic deuteration strategy for continuous production of deuterated ethylene from acetylene under ambient conditions. Specially, Ag nanoparticles exhibit a very high deuterated ethylene Faradic efficiency of up to 99.3% at –0.6 V vs. reversible hydrogen electrode. Meanwhile, Ag nanoparticles achieve a deuterated ethylene production rate of 3.72 × 103 mmol h–1 gcat–1 and an excellent long-term stability with deuterated ethylene Faradaic efficiencies of ~95% in a two-electrode flow cell, which substantially outperform state-of-the-art values for previously reported deuterated alkenes. In-situ electrochemical Infrared absorption and Raman spectroscopies reveal superior acetylene absorption and formation of deuterated ethylene on Ag nanoparticles. This efficient electrocatalytic deuteration strategy opens a new window for continuous and economic production of deuterated alkenes.
Ce-doped MIL-125-NH2 coupled Ce4+/Ce3+ and Ti4+/Ti3+ redox mediators for thermo-enhanced photocatalytic oxidative desulfurization
Kaiyue Zhang , Feng Chu , Yezi Hu , Xiubing Huang , Guixia Zhao , Ge Wang
2023, 34(5): 107766  doi: 10.1016/j.cclet.2022.107766
[Abstract](2296) [FullText HTML] [PDF 2756KB](13)
Abstract:
Photocatalytic oxidative desulfurization (PODS) over efficient earth-abundant catalysts to obtain clean fuel oil is of great importance for the environmental protection. In this work, a series of Ce-doped MIL-125-NH2 photocatalysts were successfully prepared via a simple in-situ doping method and exhibited superior PODS performance of dibenzothiophene (DBT) under mild reaction conditions. The 1.0 mol% Ce/MIL-125-NH2 catalyst achieved 100% sulfur removal within 22 min at 30 ℃ under visible light illumination, which is mainly attributed to the high surface area and the formation of Ce-Ti-oxo clusters due to electronic coupling. The valence transformation of Ce4+/Ce3+ and Ti4+/Ti3+ redox mediators could not only expose abundant Lewis acid sites, but also promote the separation and transfer of photogenerated charges. In addition, increasing the reaction temperature has been demonstrated to be effective in promoting the PODS performance. Additionally, a thermo-enhanced PODS mechanism was proposed over Ce/MIL-125-NH2, demonstrating the great potential of thermal energy to promote the desulfurization activity.
Promotion effect of bulk sulfates over CeO2 for selective catalytic reduction of NO by NH3 at high temperatures
Jiawei Ji , Li Han , Wang Song , Jingfang Sun , Weixin Zou , Changjin Tang , Lin Dong
2023, 34(5): 107769  doi: 10.1016/j.cclet.2022.107769
[Abstract](2136) [FullText HTML] [PDF 2617KB](3)
Abstract:
Understanding the influence of sulfates over catalysts for selective catalytic reduction of NO with NH3 (NH3-SCR) is crucial due to the universal presence of SO2 in exhaust gas. Depending on the degree of sulfation, there mainly exist surface and bulk sulfates and NH3-SCR activity is generally considered to suffer more from bulk sulfates. Herein, the unique function of bulk sulfates over CeO2 in promoting high-temperature SCR reaction is revealed. Notably, compared with CeO2 dominated with surface sulfates (S-CeO2–4h) and commercial V2O5-WO3/TiO2, CeO2 with bulk sulfates (S-CeO2–72h) exhibits admirable NO conversion at the temperature range of 400–550 ℃. Bulk sulfates provide more Brønsted acid sites with stronger strength for NH3 adsorption. Moreover, the oxidation ability of CeO2 is significantly inhibited due to electron-withdrawing effect from bulk sulfates, which alleviates NH3 oxidation at high temperatures. More NH3 adsorption with high stability and limited NH3 oxidation capacity ensure the excellent catalytic performance for S-CeO2–72h in high-temperature denitration. This work provides new insight of bulk sulfates in promoting SCR activity and open a new avenue to design deNOx catalysts employed at high temperatures.
Tuning electron delocalization and surface area in COFs derived N, B co-doped carbon materials for efficient selective hydrogenation of nitroarenes
Hao Hu , Chunlei Song , Di Wang , Yinglong Tao , Shijian Zhou , Yan Kong
2023, 34(5): 107770  doi: 10.1016/j.cclet.2022.107770
[Abstract](2059) [FullText HTML] [PDF 2321KB](6)
Abstract:
Metal-free carbon catalysts with excellent conduction performance have drawn much research attention in reduction reactions. Herein, a N, B co-doped carbon catalyst with high pyrrolic N proportion (35.75%) and excellent surface area (1409 m2/g) was successfully prepared via carbonizing covalent organic framework materials (COFs) containing N and B atoms assisted by ZnCl2 molten salt. The presence of ZnCl2 maintains the micropore structure of COFs to provide high specific surface areas and abundant lattice defects for carbon materials. In addition, electron-withdrawing B heteroatom further facilitates the formation of pyrrolic N at defect sites by modifying the electronic structure of carbon network. The tuning of surface areas and active N species in carbon catalysts successfully improve the selective hydrogenation of nitrobenzene to aniline. The optimized carbon material exhibits excellent nitrobenzene conversion (99.9%) and aniline selectivity (> 99%) within 15 min, as well as excellent substrate suitability. This work provides a certain guiding for the design and application of metal-free catalysis.
Cell mechanics and energetic costs of collective cell migration under confined microchannels
Xiao-Hong Wang , Yu Liu , Bin Kang , Jing-Juan Xu , Hong-Yuan Chen
2023, 34(5): 107789  doi: 10.1016/j.cclet.2022.107789
[Abstract](2326) [FullText HTML] [PDF 4204KB](3)
Abstract:
Mechanical force between cells relates to many biological processes of cell development. The cellular collective migration comes from cell-cell cooperation, and studying the intercellular mechanical properties helps elucidate collective cell migration. Herein, we studied cell-cell junctions, intercellular tensile force and the related cellular energetic costs in confined microchannels. Using the intercellular force sensor, we found that cells adapt to different confinement environments by regulating intercellular force, and thereby the relationship between collective cell migration and cell-cell junction were verified. Through the observation of cell orientation, actomyosin contractility, energetic costs, and glucose uptake, we can make a reasonable explanation of cell-force driven migration in different confined environments. Under highly confined conditions, the intercellular force and energetic costs are greater, and the cell orientation is more orderly. The collective migration behavior in confined spaces is closely related to the intercellular force and energetic costs, which is helpful to understand the collective migration behaviors in various confined spaces.
An integrated microfluidic chip-mass spectrometry system for rapid antimicrobial resistance analysis of bacteria producing β-lactamases
Zhaochen Su , Wanting Hu , Lizhen Ye , Dan Gao , Jin-Ming Lin
2023, 34(5): 107790  doi: 10.1016/j.cclet.2022.107790
[Abstract](3248) [FullText HTML] [PDF 1688KB](5)
Abstract:
Bacteria producing β-lactamases have become a major issue in the global public health field. To restrain the development of drug resistance and reduce the abuse of antibiotics, it is very important to rapidly identify bacteria producing β-lactamases and put forward a reasonable treatment plan. Here, an integrated microfluidic chip-mass spectrometry system was proposed for rapid screening of β-lactamase-producing bacteria and optimization of β-lactamase inhibitor dosing concentration. The concentration gradient generator followed by an array of bacterial culture chambers, as well as micro-solid-phase extraction columns was designed for sample pretreatment before mass analysis. By using the combination system, the process of the hydrolysis of antibiotics by β-lactamase-producing bacteria could be analyzed. To validate the feasibility, four antibiotics and two antibiotic inhibitors were investigated using three strains including negative control, SHV-1 and TEM-1 strains. SHV-1 and TEM-1 strains were successfully distinguished as the β-lactamase producing strains. And the acquired optimal concentrations of β-lactamase inhibitors were in accordance with the results by that obtained from the traditional microdilution broth method. The total analysis time only needed around 2 h, which was faster than conventional methods that require a few days. The technique presented herein provides an easy and rapid protocol for β-lactamase resistance related studies, which is important for the inhibition of antimicrobial resistance development and the reduction of antibiotics abuse.
Structure-property relationship on aggregation-induced emission properties of simple azine-based AIEgens and its application in metal ions detection
Xiao-Mei Sun , Juan Liu , Zhao-Hui Li , Yong-Peng Fu , Ting-Ting Huang , Zhong-Di Tang , Bingbing Shi , Hong Yao , Tai-Bao Wei , Qi Lin
2023, 34(5): 107792  doi: 10.1016/j.cclet.2022.107792
[Abstract](2609) [FullText HTML] [PDF 5161KB](8)
Abstract:
In recent twenty years, aggregation-induced emission (AIE), due to its excellent application prospect, has aroused widespread interests. The development of novel and easy to make AIE luminogens (AIEgens) is an attractive subject. For this purpose, it is very important to study the structure-property relationship of AIEgens. Because azine derivatives are easy to synthesis and some of them have nice AIE properties, herein, a series of azine derivatives (ADs) were employed as models to study the influence of different functional groups, electronic effects and structures on the AIE properties of azine derivatives. The AIE mechanism were studied by single crystal analysis, density functional theory (DFT) calculations and so on. The results indicated that the o-hydroxyl aryl substituted azine compounds could show good AIE properties. Meanwhile, the AIE properties of o-hydroxyl aryl substituted azine compounds were also influenced by the electronic effects of the aryl groups in the azine compounds. The o-hydroxyl groups could form intramolecular hydrogen bond with imine group, which play key role to restrict the intramolecular rotation of the aryl groups and act as base stone for the AIE process of this kind compounds. The HOMO-LUMO energy gaps of o-hydroxyl substituted azine are smaller than other homologous compounds, which is agree with the proposed AIE mechanism. Finally, thanks to the AIE properties, the o-hydroxy-substituted azines could be used as efficient Al3+ and Cu2+ fluorescent chemosensors in different conditions. In addition, test strips based on AD10 has been prepared, which can conveniently detect Cu2+ in industrial wastewater. This research supplied a way for the design of novel easy to make AIEgens through simple azine derivatives.
Ultrabroad-band, white light emission from carbon dot-based materials with hybrid fluorescence/phosphorescence for single component white light-emitting diodes
Yuchen Li , Qijun Li , Shuai Meng , Yukun Qin , Dengke Cheng , Hailing Gu , Zifei Wang , Yunxia Ye , Jing Tan
2023, 34(5): 107794  doi: 10.1016/j.cclet.2022.107794
[Abstract](2612) [FullText HTML] [PDF 3879KB](3)
Abstract:
Benefiting from the large Stokes shift between fluorescence and phosphorescence, fluorescence/phosphorescence dual-emitting carbon dots (CDs) have gradually entered at the stage of single-phase white light-emitting diodes (WLEDs) as 'green material'. However, most of the developed dual-emitting CDs have weak phosphorescence, short emission wavelength and narrow emission band, resulting in relatively bluish white light emission and low color rendering index (CRI). Herein, an ultrabroad-band fluorescence/phosphorescence dual-emitting CD-based material (UB-CD@BA) is prepared by thermal treatment of boric acid (BA) and CDs with large conjugated structure. The stable covalent bonding between CDs and BA, as well as three-dimensional spatial restriction effect of self-polymerization BA molecules around CDs during long-term heating efficiently rigidified the single/triplet excited states of CDs from non-radiative deactivation, thus producing strong dual emissive materials with the high phosphorescence quantum yield of 21%. Remarkable, the prepared UB-CD@BA powders exhibit bright pure white light emission with Commission Internationale de l'Eclairage (CIE) coordinates of (0.32, 0.33) and the highest reported full width at half maximum of 250 nm. Based on the unique characteristics of UB-CD@BA, it was used as a color conversion layer to prepare a WLED with CIE coordinates of (0.35, 0.33) and the CRI value of 87.
Synthesis, nematicidal evaluation, and SAR study of benzofuran derivatives containing 2-carbonyl thiophene
Xiaofeng Cao , Die Qiu , Ruifeng Zhang , Zhong Li , Xiaoyong Xu
2023, 34(5): 107800  doi: 10.1016/j.cclet.2022.107800
[Abstract](2621) [FullText HTML] [PDF 992KB](9)
Abstract:
Plant-parasitic nematodes are major threat for crop protection. The lack of nematicides with new mode of action and increasing resistance raises the need for novel nematicides. In order to seek new nematicidal lead, originating from the structure of chalcone, a series of fused ring compounds was obtained by ring closure design strategy. These compounds were modified further. The nematicidal activity against M. incognita of synthesized compounds was evaluated. The bioassay showed that compound 3 and some of its derivatives such as compounds 18, 19, 21, 22, 23, 24 and 26 exhibited excellent nematicidal activity. Among them, compound 23 exhibited significant bioactivity. The LC50/72 h value reached 3.20 mg/L in vitro and the inhibition rate was 100.00% at 40 mg/L in the matrix. The structure-activity relationship of synthesized compounds was discussed in details. The influence of compound 23 on egg hatching, motility, and feeding behavior of C. elegans was also evaluated.
Leveraging nano-engineered mesenchymal stem cells for intramedullary spinal cord tumor treatment
Lu Tang , Mengying Xie , Jing Li , Yijun Mei , Yuqi Cao , Qiaqia Xiao , Haijuan Dong , Yuhui Zhang , Wei Wang
2023, 34(5): 107801  doi: 10.1016/j.cclet.2022.107801
[Abstract](3243) [FullText HTML] [PDF 8155KB](7)
Abstract:
Intramedullary spinal cord tumor (IMSCT) is comparatively rare malignant tumor in the central nervous system and is very difficult accessible by conventional chemotherapy regimen. Currently, there are very limited researches for IMSCT treatment using nanomedicine. To fill this gap, we originally reported a targeted strategy by leveraging nano-engineered mesenchymal stem cells (MSCs) for synergistic anti-IMSCT treatment. In this study, two mode drugs paclitaxel (PTX) and metformin (MET) were co-loaded in maleimide-modified poly(lactic-co-glycolicacid) (PLGA-MAL) nanoparticles, which were further conjugated onto MSCs surface via the thioether bond formed between PLGA-MAL and MSCs without affecting the migration ability of MSCs. Owing to the excellent tumor tropism and penetrability of MSCs and good biodegradability of PLGA, the designed drug delivery platform could accurately target IMSCT sites to exert long-term synergistic antitumor efficacy, exhibiting promising research value for alternative IMSCT management beyond surgery.
Surfactant-regulated acetylpyrene assemblies as fluorescent probes for identifying heme proteins in an aqueous solution
Binbin Yuan , Shuangshuang Long , Huamin Wang , Qing Luo , Ke Zeng , Shuqin Gao , Yingwu Lin
2023, 34(5): 107802  doi: 10.1016/j.cclet.2022.107802
[Abstract](2008) [FullText HTML] [PDF 2588KB](3)
Abstract:
Heme proteins play various important roles in a variety of physiological and pathological processes. Surfactant assemblies have drawn great attention in fabricating fluorescent sensors to detect and identify proteins. In this study, an acetylpyrene fluorophore containing imidazole HP-1 was synthesized, and it could be well modulated by an anionic surfactant sodium dodecyl sulfate (SDS). The selected ensemble based on HP-1/SDS assemblies exhibited selective fluorescence sensing performance towards the heme proteins, including neuroglobin (Ngb), myoglobin (Mb) and cytochrome c (Cyt c). Besides, phospholipid DMPC vesicles as membrane models were particularly explored the association process between the heme protein Mb and membrane. The present work showed that Mb induced the lysis of DMPC liposomes visualized by transmission electron microscopy and optical microscope.
QM/MM study on the O2 activation reaction of 4-hydroxylphenyl pyruvate dioxygenase reveals a common mechanism for α-ketoglutarate dependent dioxygenase
Linhui Li , Suitian Lai , Hongyan Lin , Xinyun Zhao , Xin Li , Xi Chen , Junjun Liu , Guangfu Yang , Changguo Zhan
2023, 34(5): 107803  doi: 10.1016/j.cclet.2022.107803
[Abstract](2545) [FullText HTML] [PDF 999KB](4)
Abstract:
The dioxygen activation catalyzed by 4-hydorxylphenyl pyruvate dioxygenase (HPPD) were reinvestigated by using hybrid quantum mechanics/molecular mechanics (QM/MM) approaches at the B3LYP/6-311++G(d, p): AMBER level. These studies showed that this reaction consisted of two steps including the dioxygen addition/decarboxylation and hetero OO bond cleavage, where the first step was found to be rate-determining. The former step initially runs on a septet potential energy surface (PES), then switches to a quintet PES after crossing a septet/quintet minimum energy crossing point (MECP) 5-7M2, whereas the rest step runs on the quintet PES. The reliability of our theoretical predictions is supported by the excellent agreement of the calculated free-energy barrier value of 16.9 kcal/mol with available experimental value of 16–17 kcal/mol. The present study challenges the widely accepted view which holds that the O2 activation catalyzed by α-keto glutamate (α-KG) dioxygenase mainly runs on the quintet PES and provides new insight into the catalytic mechanism of α-KG dioxygenase and/or other related Fe(Ⅱ)-dependent oxygenase.
Synthesis of a conjugable hexasaccharide corresponding to the capsular polysaccharide of Campylobacter jejuni strain BH0142
Zijiao Hou , Jianjun Wang , Xinxin Zhang , Peng Wang , Ni Song , Ming Li
2023, 34(5): 107804  doi: 10.1016/j.cclet.2022.107804
[Abstract](2841) [FullText HTML] [PDF 1336KB](24)
Abstract:
The first assembly of a conjugation-ready hexasaccharide from the capsular glycan of C. jejuni. strain BH0142 has been accomplished. The synthesis features the efficient preparation of 6-deoxy-d-ido-heptopyranosyl fluoride donors proceeding from allyl α-d-C-glucopyranoside by a C1-to-C5 switch strategy with radical dehydroxymethylative fluorination as a key step, stereocontrolled construction of 1,2-trans-α-d-ido-heptopyranosidic bonds and of 1,2-cis-α-d-galactopyranosidic linkages. The obtained target oligosaccharide sets a solid foundation for making structurally-defined multivalent glycoconjugate vaccine candidates against C. jejuni. infections.
Reactive oxygen specie-induced photodynamic therapy activation by supramolecular strategy
Shuyi Wang , Zizhen Zhao , Jiayang Yao , Siyang Jiang , Zhan-Ting Li , Da Ma
2023, 34(5): 107805  doi: 10.1016/j.cclet.2022.107805
[Abstract](2728) [FullText HTML] [PDF 3920KB](2)
Abstract:
Photodynamic therapy (PDT) agents may accumulate in skin and cause severe skin cytotoxicity. We report a pro-guest-based supramolecular strategy to selectively activate PDT in the reactive oxygen specie (ROS) overexpressed microenvironment, which is often existing in tumor and inflammatory tissues. PDT agents methylene blue (MB) and basic blue 17 (BB17) are used as model drugs. When encapsulated by acyclic cucurbit[n]uril (CB[n]), the efficacy of PDT agents is significantly inhibited. By contrast, in the presence of ROS (H2O2) and pro-guest, PDT agents are displaced and reactivated to show a dramatically enhanced PDT efficacy in cells.
Chemical protein synthesis elucidates key modulation mechanism of the tyrosine-O-sulfation in inducing strengthened inhibitory activity of hirudin
Ye Yang , Mingchan Liang , Rui Wang , Chunmao He
2023, 34(5): 107806  doi: 10.1016/j.cclet.2022.107806
[Abstract](2602) [FullText HTML] [PDF 2854KB](8)
Abstract:
Tyrosine sulfation is an important post-translational modification that enhances the inhibitory activity of hirudin. Herein, we developed a facile synthetic strategy to afford the sulfated hirudins with up to three modifications and in multi-milligram scales, after a single HPLC purification step. Through these synthetic proteins, a novel type of modulation mechanism exhibited by tyrosine sulfation was proposed, which would help to delineate the structure–function relationships in other sulfated proteins and more importantly, to serve as a basis for the development of related antithrombotic agents.
Optimizing oxygen redox kinetics of M-N-C electrocatalysts via an in-situ self-sacrifice template etching strategy
Yang Yuan , Jingwen Wang , Wenbo Shi , Xinyi Bai , Ge Li , Zhengyu Bai , Lin Yang
2023, 34(5): 107807  doi: 10.1016/j.cclet.2022.107807
[Abstract](2661) [FullText HTML] [PDF 5069KB](4)
Abstract:
The accessibility and mass transfer between catalytic sites and substrates/intermediates are essential to a catalyst's overall performance in oxygen electrocatalysis based energy devices. Here, we present an "in-situ self-sacrifice template etching strategy" for reconstructing MOF-derived M-N-C catalysts, which introduces micro‑meso-macro pores with continuous apertures in a wide range and a central hollow-out structure to optimize the electrochemical oxygen redox kinetics. It is realized via one-step pyrolysis of ZIF-8 single crystal epitaxially coating on a multi-functional template of the Fe, Co co-loaded mesoporous ZnO sphere. The ZnO core is reduced during the general pyrolysis of ZIF-8 into M-N-C and acts as a pore former to etch the surrounding ZIF-8 shell into diverse channels anchoring highly exposed Fe and Co-based active sites with edge enrichment. The redesigned catalyst reveals apparent structural benefits towards enhanced oxygen redox kinetics as bifunctional cathode catalysts of rechargeable zinc-air battery compared with the primitive bulk M-N-C catalysts and the mixture of commercial Pt/C and Ir/C. The unique structure-based activity advantages, the omitted template removal step and good template compatibility during synthesis make the strategy universal for the channel engineering of electrocatalysts.
An efficient nanodiamond-based monolithic foam catalyst prepared by a facile thermal impregnation strategy for direct dehydrogenation of ethylbenzene to styrene
Guifang Ge , Xiaojing Wei , Hongchen Guo , Zhongkui Zhao
2023, 34(5): 107808  doi: 10.1016/j.cclet.2022.107808
[Abstract](3422) [FullText HTML] [PDF 1996KB](8)
Abstract:
Nanodiamond (ND) has long been recognized as an effective carbocatalyst for synthesizing styrene via direct dehydrogenation (DDH). However, the induced drastic pressure drop of its powder form limits its industrial application in heterogeneous catalytic process. In this work, we report a facile hexamethylenetetramine nitrate (HN)-assisted thermal impregnation (HNTI) strategy for fabricating a novel nanodiamond-based monolithic foam (ND/CNT-SiC-ms-HN) catalyst through a two-step approach: One is to soak the carbon nanotube-modified SiC foam (CNT-SiC) with the slurry composed of HN, KCl, LiCl, and dispersed ND, and the other is to heat the slurry-soaked CNT-SiC (ND-HN-KCl-LiCl/CNT-SiC) in N2 atmosphere at 750 ℃. The as-synthesized ND/CNT–SiC-ms-HN monolithic foam features the enriched surface kenotic CO by promoted ND dispersion and O-doping, abundant stuctural defects, and improved nucleophilicity by N-doping, originating from the promoted ND dispersion by thermal impregnation (TI) in KCl-LiCl molten salt (MS) and the presence of HN in the annealing process. As a result, the ND/CNT–SiC-ms-HN monolithic foam catalyst by HNTI strategy exhibits 1.5 folds higher steady-state styrene rate (5.49 mmol g−1 h−1) associated with 98.4% of styrene selectivity compared to the ND-based monolithic foam catalyst (ND/CNT-SiC). Moreover, the ND/CNT–SiC-ms-HN monolithic foam shows excellent long-term stability for the direct dehydrogenation of ethylbenzene to styrene. This work also comes up with a novel way of preparing other highly-dispersed nanocarbons-based monolithic foam catalysts with promising catalytic performance for diverse transformations.
Density functional theory calculations on 2H-MoS2 monolayer for HCHO degradation: Piezoelectric-photocatalytic synergy
Yushan Zhu , Weina Zhao , Binghua Jing , Junhui Zhou , Bihai Cai , Didi Li , Zhimin Ao
2023, 34(5): 107816  doi: 10.1016/j.cclet.2022.107816
[Abstract](2617) [FullText HTML] [PDF 1595KB](8)
Abstract:
Formaldehyde (HCHO) is a common indoor gaseous pollutant, and long-term exposure to it may cause serious damage to the human immune system. Photocatalytic degradation of HCHO is a promising technique. However, most photocatalysts have the disadvantage of rapid recombination of photo-generated electron-hole pairs. In this work, the recombination of photogenerated electron holes was proposed to inhibit through the piezoelectric effect. A two-dimensional (2D) piezoelectric material, 2H-MoS2, was selected to investigate the catalytic performance for HCHO degradation by the synergy of the piezoelectric and photocatalysis properties. The results show that the piezoelectric effect can induce the polarization in 2H-MoS2 and inhibit the recombination of photogenerated electron-hole pairs, thus improving the photogeneration of hydroxyl radicals for HCHO degradation. Therefore, the piezoelectric-photo-catalysis synergistic effect based on density functional theory (DFT) calculation was proposed to elucidate the HCHO degradation performance. This work could provide important guidance for the development of effective catalysts for HCHO degradation and the application of 2D piezoelectric materials.
Spiropyran isomerization triggering ESIPT for visualization of pH fluctuations during oxidative stress in living cells
Jingdong Wang , Fangjun Huo , Yongbin Zhang , Caixia Yin
2023, 34(5): 107818  doi: 10.1016/j.cclet.2022.107818
[Abstract](3193) [FullText HTML] [PDF 3267KB](7)
Abstract:
Intracellular pH homeostasis is foundation of maintaining normal physiological functions. More and more evidences show that intracellular pH fluctuations were usually associated with many diseases (such as cancer, epilepsy and neurodegenerative diseases). It is very important to develop in situ real-time determination of pH. In recent years, it has been verified that pH can regulate the isomerization process of spiropyran. Thus, we report a pH fluorescent probe BSL, which is a closed loop spiropyran structure by coupling benzothiazole derivatives with indole salts. We utilizes the process of spiropyran isomerization as the trigger of excited state intramolecular proton transfer (ESIPT) effect, and adjust the process of spiropyran isomerization through pH, and then the molecular transformation from enol to ketone (enol: 525 nm, ketone: 677 nm) through the ESIPT effect. This process achieved accurate measurement of pH. The probe BSL showed sensitive and reversible fluorescence response to pH in vitro. Ultimately, BSL was successfully applied to detect pH fluctuations in cell oxidative stress model.
Aryldiazonium salts can serve as nitrogen-based Lewis acid catalysts and their applications in the formation of photoactive charge transfer complexes
Xiaojian Ren , Qiang Liu , Zhusheng Yang , Zhixiang Wang , Xiangyu Chen
2023, 34(5): 107821  doi: 10.1016/j.cclet.2022.107821
[Abstract](3178) [FullText HTML] [PDF 2330KB](10)
Abstract:
We report the Lewis acid catalysis of aryldiazonium salts, and their Lewis acidity applications in photogeneration of aryl radicals under additive-, photocatalyst- and transition metal-free conditions. In this visible light-mediated transformation, the Lewis acidic character of aryldiazonium salts enables access to the photoactive charge transfer complex with dichalcogenides. The usefulness and versatility of this new protocol are demonstrated through the chalcogenation of a variety of aryldiazonium salts.
Photoredox-neutral ring-opening pyridylation of cyclic oximes via phosphoranyl radical-mediated NO/CC bond cleavages and sequential radical-radical coupling
Ting Zou , Yishu He , Rui Liu , Yihao Zhang , Siping Wei , Ji Lu , Jun Wang , Lin Wang , Qiang Fu , Dong Yi
2023, 34(5): 107822  doi: 10.1016/j.cclet.2022.107822
[Abstract](3401) [FullText HTML] [PDF 1598KB](15)
Abstract:
A novel photoredox-neutral ring-opening pyridylation of non-prefunctionalized cyclic oximes has been accomplished through phosphoranyl radical-mediated NO/CC bond cleavages followed by radical-radical coupling. This mild acid-, base-, and oxidant-free protocol provides highly site-selective and efficient access to distally pyridylated alkylnitriles, which could be scale-up synthesized and readily converted into skeletally diverse compounds. Notably, the oxidized ground-state photocatalyst generated via the SET oxidation of the highly reducing excited-state photocatalyst by cyanopyridines might initiate the following phosphoranyl radical-mediated deoxygenative process.
[4 + 3] Cycloaddition of ketenimines with furocarbenoids: Divergent and efficient synthesis of fused cycloheptatriene and tropone scaffolds
Jin Wang , Zhaoyang Li , Shengxin Bai , Qinghua Zhou , Tengteng Wu , Zhongyan Hu , Xianxiu Xu
2023, 34(5): 107823  doi: 10.1016/j.cclet.2022.107823
[Abstract](2870) [FullText HTML] [PDF 1952KB](11)
Abstract:
An unprecedent [4 + 3] cycloaddition of furoketenimines with furocarbenoids has been disclosed for the divergent and efficient synthesis of cycloheptafuran and cycloheptapyrrole scaffolds. Zinc chloride acted as promoters for both the formation of these two transient intermediates from isocyanides and ene-yne-ketones, and the subsequent construction of seven-membered ring. Three rings and five bonds were constructed successively in this three-component one-pot domino reaction.
Highly dispersed L12-Pt3Fe intermetallic particles supported on single atom Fe-Nx-Cy active sites for enhanced activity and durability towards oxygen reduction
Tuo Zhao , Yang Li , Jie Liu , Xian Wang , Jiayi Zhang , Changpeng Liu , Wei Xing , Junjie Ge
2023, 34(5): 107824  doi: 10.1016/j.cclet.2022.107824
[Abstract](3305) [FullText HTML] [PDF 4380KB](6)
Abstract:
Highly active and durable oxygen reduction reaction (ORR) catalysts with sufficient activity and stability of Pt are beneficial for the commercialization of proton exchange membrane fuel cells. Here we report an effective approach to prepare a composite catalyst comprising of ordered L12-Pt3Fe intermetallic nanoparticles interact with single atom Fe-Nx-Cy active sites. The addition of Fe and the confinement effect of hierarchical porous structure limit the growth of intermetallic particle size (around 2.5 nm). The ligand effect of the electron transfer from Fe to Pt and the synergistic interaction between L12-Pt3Fe and Fe-Nx-Cy work together to reduce oxygen intermediates adsorption and improve kinetics process. Experimentally, the L12-Pt3Fe/CFe-N-C catalyst shows high mass activity and specific activity at 1.010 A/mgPt and 1.166 mA/cm2, respectively, which are 5.8 and 5.1 times higher than those of commercial Pt/C (0.174 A/mgPt and 0.230 mA/cm2). Thanks to the more stable L12 structure, L12-Pt3Fe/CFe-N-C exhibits better durability (14 mV E1/2 loss of L12-Pt3Fe/CFe-N-C and 33 mV E1/2 loss of commercial Pt/C) after 30,000 cycles accelerated stress tests. The strategy to design and prepare small particle Pt-based intermetallic alloys coordinated with M-N-C active sites provides a new direction to obtain low-cost and easily prepared effective ORR catalysts.
Iron-based metal–organic framework as a dual cooperative release system for enhanced vascularization and bone regeneration
Chang Xu , Yue Kang , Shiqiang Guan , Xufeng Dong , Daqing Jiang , Min Qi
2023, 34(5): 107825  doi: 10.1016/j.cclet.2022.107825
[Abstract](3223) [FullText HTML] [PDF 4343KB](8)
Abstract:
Vascularization and bone regeneration are closely related in the process of bone remodeling, and designing a bioactive scaffold with pro-angiogenic and osteogenic properties may accelerate the repair of bone defects. In this work, an iron-based metal–organic framework (MIL-88) was developed as a carrier for loading a pro-angiogenic small molecular drug (dimethyloxallyl glycine, DMOG), and then embedded into the PLGA nanofibrous scaffolds to repair cranial defects in rats. Imaging and histological evaluation indicated that PLGA/MIL@D scaffold markedly enhanced vascularization and bone regeneration in vivo. Moreover, in vitro assay showed that co-delivery system significantly promoted angiogenesis by stimulating endothelial cell migration, tube formation, and enhanced osteogenesis by promoting expression of osteoblast related proteins. In addition, PLGA/MIL@D scaffold promotes angiogenesis by activating the hypoxia-inducible factor-1 (HIF-1)/vascular endothelial growth factor (VEGF) signaling pathway. Altogether, this bioactive PLGA/MIL@D scaffold can combine angiogenesis with osteogenesis, and will be a bright strategy for the repair of bone defects.
A non-two-dimensional van der Waals InSe semispherical array grown by vapor–liquid–solid method for hydrogen evolution
Jun Wang , Tao Liang , Huihui Li , Junjie Xiong , Bowen Liu , Xiaohui Xu , Yang Gao , Zhongliang Yu , Qiang Zheng , Shouting Zhang , Bin Wang
2023, 34(5): 107826  doi: 10.1016/j.cclet.2022.107826
[Abstract](2960) [FullText HTML] [PDF 2676KB](3)
Abstract:
Two-dimensional (2D) layered materials with layer-number dependent properties are promising candidates for next-generation noble-metal-free electrocatalytic reaction. However, the main group metal chalcogenides (MMCs) used for this purpose are rarely explored. Herein, we report the controlled growth of indium selenide (InSe) with a novel morphology (semispherical array) on a silicon substrate and its application in hydrogen evolution reaction (HER). The formation of the spherical InSe is explained with a vapor-liquid-solid growth mechanism, in which the distribution and size of the spheres could be facilely tuned by the reaction parameters. The InSe semispherical array was demonstrated as more efficient catalyst for HER than the flake-like 2D InSe counterparts, originating from the fully exposed InSe spherical surface with abundant adsorbing sites and the high crystalline quality for electron transport. This work provides a controlled synthesis way of the layered InSe with a distinct spherical morphology used for the electrocatalysis applications and could be extended to other main group metal chalcogenides.
Diagnosis and subtype classification on serum peptide fingerprints by mesoporous polydopamine with built-in metal-organic framework
Zixing Xu , Haolin Chen , Huimin Chu , Xizhong Shen , Chunhui Deng , Nianrong Sun , Hao Wu
2023, 34(5): 107829  doi: 10.1016/j.cclet.2022.107829
[Abstract](2773) [FullText HTML] [PDF 2047KB](3)
Abstract:
Crohn's disease (CD) as a big issue to public health needs an accurate diagnosis urgently that is the common challenge among internal diseases. Herein, we design a mesoporous polydopamine with built-in metal-organic frameworks (dubbed MMP-b-MOFs) to combine with high-throughput mass spectrometry to extract serum peptide fingerprints from CD and healthy controls (HC). Benefitting by the size-exclusion and strong hydrophilicity of MMP-b-MOFs, the extracted peptide fingerprints present extremely high quality. CD and HC are explicitly discriminated with orthogonal partial least squares discriminant analysis (OPLS-DA), the corresponding area under the curve (AUC) value is 1.000. Moreover, eight peptides with clear identity are screened out and achieve the accurate diagnosis and subtype classification of CD, with all AUC values up to 1.000. Moreover, the unsupervised model is also established to precisely classify HC and CD based on these eight clearly identified peptides. This work brings great benefits for clinical detection especially internal medicine.
Low-molecular-weight supramolecular adhesive with resistance to low temperatures
Shuanggen Wu , Wenbo Wang , Changyong Cai , Fenfang Li , Shengyi Dong
2023, 34(5): 107830  doi: 10.1016/j.cclet.2022.107830
[Abstract](2163) [FullText HTML] [PDF 3886KB](6)
Abstract:
The design of adhesive materials with strong adhesion capacity at low temperatures is a great challenge. Herein, we report a low-molecular-weight supramolecular adhesive that exhibits good adhesion performance to various surfaces at low temperatures (from −18 ℃ to −80 ℃). Moreover, this supramolecular adhesive has good adhesion ability in the presence of water.
Machine learning accelerated DFT research on platinum-modified amorphous alloy surface catalysts
Xi Zhang , Kangpu Li , Bo Wen , Jiang Ma , Dongfeng Diao
2023, 34(5): 107833  doi: 10.1016/j.cclet.2022.107833
[Abstract](2785) [FullText HTML] [PDF 2434KB](13)
Abstract:
Pt-modified amorphous alloy (Pt@PdNiCuP) catalyst exhibits excellent electro-catalytic activity and high experimental durability for hydrogen evolution reaction (HER). However, the physical origin of the catalytically active remains unclear. In this paper, we constructed a distance contribution descriptor (DCD) for the feature engineering of machine learning (ML) potential, and calculated the Gibbs free energies (ΔGH) of 46,000 *H binding sites on the Pt@PdNiCuP surface by ML-accelerated density functional theory (DFT). The relationship between ΔGH and DCD revealed that in the H-Pt distance region of 2.0–2.5 Å where the parabolic tail and disordered scatters coexist, the H-metal bonding configuration is mainly the bridge- or hollow- bonding type. The contribution analysis of DCD indicates that the joint effect of Pt, Pd and Ni atoms determines the catalytical behavior of amorphous alloy, which agrees well with experimental results. By counting atomic percentages in different energy intervals, we obtained the atomic ratio for the best catalytic performance (Pt:Pd:Ni:Cu:P = 0.33:0.17:0.155:0.16:0.185). Projected density of states (PDOS) show that H 1s orbital, Pt 5d orbital, and Pd 4d orbital form a bonding state at −2 eV. These results provide new ideas for designing more active amorphous alloy catalysts.
C-H···X-C bonds in alkyl halides drive reverse selectivities in confined spaces
Manuel Petroselli , Yong-Qing Chen , Ming-Kai Zhao , Julius Rebek , Yang Yu
2023, 34(5): 107834  doi: 10.1016/j.cclet.2022.107834
[Abstract](2508) [FullText HTML] [PDF 2016KB](7)
Abstract:
Binding of non-activated alkyl halides (220) in water-soluble cavitand (1) through supramolecular forces is here reported, with emphasis on the role of size and polarizability of the halogen atom in the formation of intramolecular C-H hydrogen bonds in confined spaces. Rare reverse affinity in water (RI < RBr < RCl) is surprisingly observed for the more water-soluble short alkyl halides in dynamic open-ended containers. Competitive bindings and theoretical calculations confirm the unusual selectivity and the presence of C-H hydrogen bonds in non-activated systems for the first time, pointing out the importance and effect of subtle forces on molecular recognition in confined spaces.
Evolving a novel red-emitting two-photon dye with optically tunable amino group for monitoring the degree of hypoxia during liver fibrosis
Xingxing Zhang , Feiyu Yang , Tianbing Ren , Yingxin Zheng , Xiao-Bing Zhang , Lin Yuan
2023, 34(5): 107835  doi: 10.1016/j.cclet.2022.107835
[Abstract](2685) [FullText HTML] [PDF 2724KB](14)
Abstract:
Two-photon imaging has attracted increasing attention owing to its deep tissue imaging capabilities. Therefore, many fluorophores have been developed to satisfy its requirements. However, long-wavelength emission fluorophores with an optically tunable group are rarely developed. In this study, two long-wavelength emission fluorophores with an optically tunable amino group were successfully developed by introducing strong electron acceptor and large conjugated group to the TPQL dye. TPCO2 displayed a bright red emission (λem = 638 nm, Φ = 0.15) together with high two-photon action cross section and good water solubility, which enabled higher signal-to-background ratios and deep tissue imaging. The proof-of-concept probe (TPCONO2) was successfully applied to the high signal-to-background ratio imaging of nitroreductase in liver fibrosis, further realizing diagnosis of the degree of hypoxia during liver fibrosis.
Efficient degradation of sulfacetamide by CoFe PBAs and PBA@PVDF composite membrane activating peroxymonosulfate
Ruonan Guo , Ying Chen , Ying Yang , Jiangwei Shang , Xiuwen Cheng
2023, 34(5): 107837  doi: 10.1016/j.cclet.2022.107837
[Abstract](3313) [FullText HTML] [PDF 6355KB](5)
Abstract:
More and more antibiotics that are difficult to biodegrade have been detected in water environments threatening ecosystems and human health. Therefore, it is urgent to develop efficient water treatment methods to degrade antibiotics. In this work, Co-Fe Prussian blue analogues (PBAs) with different molar ratios were synthesized for peroxymonosulfate (PMS) activation to degrade sulfacetamide (SAM, 10 mg/L). By increasing Co molar ratio, the PMS activation capability and electrochemical properties of PBAs were enhanced. Due to its excellent reactivity (degradation efficiency of 84.2% and mineralization efficiency of 52.79%), cost benefit (electrical energy per order, 0.01019 kWh/L) and lower metal leaching ([Co] = 0.259 mg/L, [Fe] = 0.128 mg/L), PBA-1, the as-prepared catalyst with a molar ratio of cobalt to iron of 1:1, was selected for further study. The radical scavenging experiments and an electron paramagnetic resonance (EPR) trapping experiments were performed and revealed that PBA-1 addition was required to produced OH and SO4•− from PMS activation. Accordingly, we proposed a PMS activation mechanism and SAM decomposition pathways for PBA-1/PMS reaction system. Besides, a PBA-1@polyvinylidene fluoride (PVDF) catalytic membrane was further prepared to expand the application potential of PBA nanoparticles. The PBA-1@PVDF catalytic membrane was highly effective and exhibited a great reusability; thus, it could be considered for applications in actual water treatment processes.
In-situ assembly of 2D/3D porous nickel cobalt sulfide solid solution as superior pre-catalysts to boost multi-functional electrocatalytic oxidation
Pin Hao , Xu Dong , Houguang Wen , Ruirui Xu , Junfeng Xie , Qian Wang , Guanwei Cui , Jian Tian , Bo Tang
2023, 34(5): 107843  doi: 10.1016/j.cclet.2022.107843
[Abstract](2028) [FullText HTML] [PDF 3131KB](3)
Abstract:
In this work, we fabricated an efficient pre-catalyst based on (Ni, Co)S2 solid solution with hierarchical architecture and high porosity to boost urea oxidation reaction and electrocatalytic oxidation of organic small molecules. The interaction between Ni and Co can optimize the electronic structure, resulting in the improved conductivity and accelerated charge transfer rate. The 2D/3D architecture can enrich more active species and endow the mass and electron transport to facilitate the surface oxidation and the following catalytic process. Post-structure and catalytic characterizations confirm the surface oxidation of (Ni, Co)S2 during the stability test, and the in-situ formed Co(Ni) based (oxy)hydroxides exhibit superior catalytic activity and facilitated charge transfer ability. As a result, the optimal (Ni, Co)S2 solid solution pre-catalyst displays facilitated catalytic behavior and good stability for multifunctional electrocatalytic oxidation, in which a high conversion of benzyl alcohol (97.50%), a good selectivity to benzoic acid (93.78%) and a satisfied faraday efficiency (91.86%) can be achieved.
Lower oxygen vacancy concentration in BiPO4 with unexpected higher photocatalytic activity
Jun Xiong , Haoxue Huang , Bo Lin , Jiexiang Xia , Jun Di
2023, 34(5): 107844  doi: 10.1016/j.cclet.2022.107844
[Abstract](2609) [FullText HTML] [PDF 2467KB](7)
Abstract:
Defect engineering has been demonstrated to be an appealing strategy to boost the photocatalytic activity of materials. However, can higher defect concentration bring about higher photocatalytic activity? This is an open question. In this work, BiPO4 photocatalysts with controllable oxygen vacancy concentrations were successfully synthesized. The photocatalytic activity of the obtained BiPO4 photocatalysts was determined by the removal of ciprofloxacin and 4-chlorophenol, as well as CO2 photoreduction. The BiPO4 materials with lower oxygen vacancy concentration could display unexpected higher photocatalytic efficiency. Through the investigation of different factors which may affect the photocatalytic performance, such as crystal structure, morphology, specific surface area, defect, and energy band structure, it can be found that the energy band structure difference was responsible for the enhanced photocatalytic activity.
Cysteine-activated fluorescence/photoacoustic integrated probe for non-invasive diagnosis of drug-induced liver injury
Rui Chen , Wenxiu Li , Rong Li , Sixin Ai , Huayong Zhu , Weiying Lin
2023, 34(5): 107845  doi: 10.1016/j.cclet.2022.107845
[Abstract](2372) [FullText HTML] [PDF 4280KB](3)
Abstract:
Hepatotoxicity is a serious problem faced by clinical drugs, and long-term administration or overdose may lead to liver failure and even death of patients. Therefore, developing a reliable detection method for the early diagnosis and therapy of drug-induced liver injury (DILI) has significant meaning. Near-infrared fluorescence (NIRF) and photoacoustic (PA) dual-modality tomography probes can be used for imaging with high sensitivity and high-resolution of disease-related markers in deep tissues. Here, we developed a novel Cys-activated NIRF and PA dual-modality imaging probe (CDR) for early diagnosis of DILI, for the first time. The organic molecular probe CDR could respond rapidly to Cys, resulting in the absorption peak red-shifted from 560 nm to 725 nm, which also leads to the activation of the PA725 signal and NIRF765 signal. In addition, the new probe CDR could be used for NIRF/PA imaging of exogenous and endogenous Cys level in live cells and mice. More importantly, CDR has also been successfully used for in situ detection of Cys in early DILI mice and evaluate the therapeutic effect of NAC. Therefore, the CDR might become a powerful tool to research the physiological effect of Cys and evaluate the degree of DILI.
Dual-emission carbonized polymer dots for ratiometric sensing and imaging of L-lysine and pH in live cell and zebrafish
Xiaoxiao Hu , Hongjing Wu , Qiang Zhang , Feng Gao
2023, 34(5): 107846  doi: 10.1016/j.cclet.2022.107846
[Abstract](3191) [FullText HTML] [PDF 5971KB](3)
Abstract:
It is highly desired to accurately and selectively detect and image intracellular L-lysine and pH in biological systems because they could act as the biomarkers in certain abnormal conditions and may give us a warning of the occurrence of diseases. It has been attracted more focuses to design new ratiometric fluorescent probe for monitoring L-lysine and pH to improve detection accuracy. Carbonized polymer dots (CPDs), which possess carbon/polymer hybrid structure rather than pure carbon structure and constitute of a carbon core and large amounts of functional groups/polymer chains on the surface, rise up as a new type of fluorescent nanomaterials and especially display many advantages for bioanalysis. In this study, o-phenylenediamine (o-PD) and poly(styrene-co-maleic anhydride) (PSMA) are used as the precursors to synthesize the desired CPDs through one-step hydrothermal amide method. The prepared CPDs display two well-resolved fluorescence emission bands, i.e., a very weak emission centered at 470 nm in blue region and a strong emission centered at 558 nm in yellow region. It is found that the two emissions are both responsive to L-lysine based on the surface passivation mechanism, whereas, only the yellow emission is responsive to pH due to the protonation/deprotonation process of the amino groups. Based on the different responsive behaviors, ratiometric detection and imaging of L-lysine and pH are achieved. The prepared ratiometric CPDs probe is successfully applied for L-lysine and pH sensing and imaging at two emission channels in live cell and zebrafish with satisfactory results.
Selective inhibition of resistant bacterial pathogens using a β-lactamase-activatable antimicrobial peptide with significantly reduced cytotoxicity
Weipan Xu , Zheng Ma , Geetika Dhanda , Jayanta Haldar , Hexin Xie
2023, 34(5): 107847  doi: 10.1016/j.cclet.2022.107847
[Abstract](2696) [FullText HTML] [PDF 2496KB](9)
Abstract:
The expression of β-lactamase, particularly metallo-β-lactamase (MBL) in bacteria has caused significant resistance to clinically important β-lactam antibiotics, including life-saving carbapenems. Antimicrobial peptides (AMPs) have emerged as promising therapeutic agents to combat antibiotic resistance. However, the cytotoxic AMPs has been one of the major concerns for their applications in clinical practice. Herein, we report a novel cephalosporin-caged AMP, which shows significantly reduced cytotoxicity, hemolytic activity, and antibacterial activity but turns highly active against bacteria upon specific hydrolysis by the antimicrobial resistance-causative β-lactamase. Further investigations demonstrate this β-lactamase-activatable AMP selectively inactivates resistant bacterial pathogens over susceptible bacteria. This strategy should be applicable to other AMPs as a potential solution for the treatment of infectious diseases caused by β-lactamase-expressing pathogenic bacteria.
Pillar[5]arene–modified peptide-guanidiniocarbonylpyrrol amphiphiles with gene transfection properties
Kaiya Wang , Minzan Zuo , Tao Zhang , Huilan Yue , Xiao-Yu Hu
2023, 34(5): 107848  doi: 10.1016/j.cclet.2022.107848
[Abstract](1853) [FullText HTML] [PDF 4783KB](2)
Abstract:
Pillar[5]arene–modified amphiphilic peptides with varying numbers of guanidiniocarbonylpyrrol (GCP) moieties have been successfully synthesized, which can self-assemble to multivalent cationic superstructures in aqueous solutions. These assembled peptides can condense DNA into various compact multimolecular aggregates to achieve successful intracellular DNA delivery and demonstrate great potential for gene transfection. Transfection efficiencies of the self-assembled superstructures have been evaluated in vitro with HeLa and HEK 293T cells. We demonstrate that GCP moiety could enhance the cell transfection ability, owing to its excellent binding towards cytomembrane. It was also found that subtle structure difference in peptides 2 and 3 could result in distinct transfection efficacy, which makes it possible to gain an in-depth understanding of their structure-activity relationship. This work presents a good example of rational structural design in achieving effective gene transfection vectors.
Regiocontrolled Rh(Ⅲ)-catalyzed C–C coupling/C–N cyclization mediated by distinctive 1,2-migratory insertion of gem–difluoromethylene allenes: Reaction development and mechanistic insight
Zhi Zhou , Kaifeng Chen , Yi Wang , Xiuhua Zhong , Shuang Lin , Hui Gao , Wei Yi
2023, 34(5): 107849  doi: 10.1016/j.cclet.2022.107849
[Abstract](2586) [FullText HTML] [PDF 2419KB](4)
Abstract:
By developing gem–difluoromethylene allenes as viable partners, regiocontrolled Rh(Ⅲ)-catalyzed redox-neutral C–C coupling/C–N cyclization has been realized to build the pyridin-2(1H)-one motifs with the embedment of a Z-configured monofluoroalkene functionality, in which either (hetero)aromatic or vinylic amides were found to be compatible. Integrated experimental and computational mechanistic studies revealed that a tandem regioselective allene 1,2-insertion/β-H elimination/hydrogen transfer/oxidative addition/cyclization/cis-β-F elimination involving an unconventional Rh(Ⅲ)-Rh(Ⅰ)-Rh(Ⅲ) catalytic cycle accounts for the established transformation. Through further FMO analysis and IGMH maps, a non-covalent weak interaction network between the gem–difluoromethylene part and the OPiv moiety was rationally defined for the unconventional and specific regioselectivity control.
Facile preparation of hierarchical Ni@Mn-doped NiO hybrids for efficient and durable oxygen evolution reaction
Yi Liu , Liang Bai , Qiqi Jia , Peitong Li , Yao Yan , Ningkai Yuan , Xiaodong Hao
2023, 34(5): 107855  doi: 10.1016/j.cclet.2022.107855
[Abstract](2548) [FullText HTML] [PDF 2510KB](4)
Abstract:
Exploring highly efficient and non-noble-metal-based electrocatalysts for oxygen evolution reaction (OER) is of great importance not only for water splitting but also for rechargeable metal-air batteries and fuel cells. Herein, we describe a simple strategy to prepare hierarchical Ni@Mn-doped NiO hybrids using flower-like Ni-Mn layered double hydroxides (NiMn-LDHs) as a precursor. After calcination at 400 ℃ for an hour under N2 atmosphere, the flower-like NiMn-LDHs transform to porous microspheres consisting of nanoparticles, in which Ni cores are encapsulated by Mn-doped NiO shells (denoted as Ni@Mn-NiO-400). Benefiting to this unique porous, core-shell structures and element doping, the as-prepared Ni@Mn-NiO-400 hybrid shows a low overpotential of 178 mV at the current density of 10 mA/cm2 and Tafel slope of 52.7 mV/dec in 1 mol/L KOH solution. More significantly, the Ni@Mn-NiO-400 hybrid also demonstrates superior stability of 98.6% after 50 h continuously testing, much higher than pristine NiMn-LDHs and commercial IrO2 catalyst. In addition, theoretical simulation shows that Ni core and Mn doping greatly affect the electronic states and electronic structure of NiO. As a result, Ni@Mn-doped NiO hybrid possesses an optimal adsorption activity towards oxygen species than NiO and undoped Ni@NiO hybrid. Considering the compositional and structural flexibility of LDHs, this work may offer a simple method to prepare other non-noble metal-based electrocatalysts for OER.
Transformation of postsynthesized F-MOF to Fe/N/F-tridoped carbon nanotubes as oxygen reduction catalysts for high power density Zn-air batteries
Ao Yu , Wangtao Long , Longtao Zhu , Yinan Zhao , Ping Peng , Fang-Fang Li
2023, 34(5): 107860  doi: 10.1016/j.cclet.2022.107860
[Abstract](2897) [FullText HTML] [PDF 3770KB](3)
Abstract:
The oxygen reduction reaction (ORR), an important process in Zn-air batteries (ZABs), shows sluggish reaction kinetics, which significantly impairs the further improvement of battery performance. Thus, rationally designing cathodic catalysts for ZABs has drawn sufficient attention. We herein synthesize and characterize Fe/N/F-tridoped CNTs (FeNFCs) by annealing the postsynthesized trifluoroacetic anhydride-modified Fe-MIL-88B-NH2 nanocrystals with melamine at high temperature in a N2 atmosphere. Benefiting from the Fe/N/F element doping, high specific surface area, and CNT structure, the FeNFC800 catalyst prepared at 800 ℃ exhibits a preferable half-wave potential of 0.829 V vs. RHE. The Zn-air battery equipped with FeNFC800 shows a high open-circuit voltage of 1.47 V, a gratifying peak power density of 196 mW/cm2, and extraordinary long-term stability, outperforming the benchmark 20% Pt/C.
Selective electroreduction of nitrate to ammonia via NbWO6 perovskite nanosheets with oxygen vacancy
Tao Feng , Fengting Li , Xiaojun Hu , Ying Wang
2023, 34(5): 107862  doi: 10.1016/j.cclet.2022.107862
[Abstract](2488) [FullText HTML] [PDF 2924KB](6)
Abstract:
Electrocatalytic nitrate reduction to ammonia (NRA) under ambient conditions is significant for carbon-neutral synthetic fuels. Nevertheless, the lack of efficient electrocatalysts with tunable nanostructure for NRA remains a grand challenge. Herein, NbWO6 nanosheets with oxygen vacancy (NbWO6-x) was demonstrated via thermal treatment and exfoliation with NH3 selectivity of 86.8% and Faradaic efficiency of 85.7% toward NRA. 1H nuclear magnetic resonance spectra coupled with 15N isotope labeling experiments proved that NH3 originated from NO3. The function of oxygen vacancy was revealed by computational studies in NRA. Moreover, the reaction mechanism and pathway of NRA could be deduced based on the results of online differential electrochemical mass spectrometry (DEMS). This work provides a selective NH3 generation strategy to decarbonize the energy-chemical sector, bridging the gap between batteries and biofuels.
Construction of nanoreactors on TiO2 nanotube arrays as a POCT device for sensitive colorimetric detection
Jingwen Xu , Chenchen Liang , Zhida Gao , Yan-Yan Song
2023, 34(5): 107863  doi: 10.1016/j.cclet.2022.107863
[Abstract](3070) [FullText HTML] [PDF 2119KB](4)
Abstract:
With increasing attention to personalized healthcare, miniaturized and easily implementable devices are desired for point-of-care testing (POCT). Herein, hydrophilic patterns were designed on freestanding TiO2 nanotube arrays (TiNTs) as nanoreactors for a naked-eye colorimetric assay. With a high aspect ratio, TiNTs can provide a long observation length combined with a limited volume. Moreover, by combining the photocatalytic property of TiO2 and spatiotemporal controllability of light, hydrophilic nanoreactors were fabricated with minimal volume, and thus the indicator and analyte are limited in a confined void by the hydrophobic surroundings, thus allowing a higher sensitivity for sensing. We believe the proposed sensing platform could provide a promising strategy in developing POCT devices for routine health monitoring.
Information encryption with a high information-carrying capacity based on a stimulus-responsive hydrogen-bonded organic framework and a smartphone
Tianran Lin , Chunsuo Tian , Ying Sun , Shendong Liu , Di Wang , Li Hou , Shulin Zhao
2023, 34(5): 107864  doi: 10.1016/j.cclet.2022.107864
[Abstract](2150) [FullText HTML] [PDF 2448KB](5)
Abstract:
Information-carrying capacity has become an important factor in the development of encryption and anti-counterfeiting. Herein, a hydrogen-bonded organic framework (HOF-PyTTA) was developed as novel anti-counterfeiting ink without rare metals and a smartphone-based APP was written for encryption and anti-counterfeiting. We found that the fluorescence of HOF-PyTTA can be quenched by Fe3+ ions and recovered by the addition of ascorbic acid. And the fluorescence of HOF-PyTTA can be enhanced by the increasing concentrations of ethanol. Based on these stimulus-response properties, four anti-counterfeiting models with gradually increased security were studied. Mode one was printed by HOFs ink and decrypted by UV light. Mode two was based on HOF-PyTTA and CsPbBr3 inks (or HOF-PyTTA-Fe3+) which are used to separately print the genuine and pirated information. A decryption reagent was applied to get the genuine information. Furthermore, we successfully construct a dynamic information encryption anti-counterfeiting model using a fluorescence array in combination with an information encryption anti-counterfeiting APP. The circular array is printed by several concentrations of HOF-PyTTA ink and different RGB thresholds are set with the help of the information encryption anti-counterfeiting APP, to obtain distinct encrypted anti-counterfeiting information, thus accomplishing a high information-carrying capacity.
Design and characterizing of robust probes for enhanced mass spectrometry imaging and spatially resolved metabolomics
Jianpeng Huang , Shanshan Gao , Kai Wang , Jin Zhang , Xuechao Pang , Junwen Shi , Jiuming He
2023, 34(5): 107865  doi: 10.1016/j.cclet.2022.107865
[Abstract](3405) [FullText HTML] [PDF 9313KB](4)
Abstract:
As for the emerging and cut edge spatially resolved metabolomics, mass spectrometry imaging (MSI) is a powerful tool that can map thousands of metabolites from bio-tissue sections without chemical labels. However, the stability, sensitivity and spatial resolution of MSI are always limited by the performance of its ionization probe. Herein, two types of probes (fine probe (P-100) and large probe (P-200)) were designed and characterized to perform air-flow assisted desorption electrospray ionization (AFA-DESI) MSI analysis for spatially resolved metabolomics. It was determined that the spray introduced by P-100 was homogenous and stable under the spray solvent at a flow rate of 5-10µL/min, while P-200 can endure a high flow rate of up to 10-30µL/min. Moreover, the MSI images were acquired by AFA-DESI-MSI with P-100 from rat brain tissue section and with P-200 from whole-body tissue section of mouse, and these results presented unambiguous tissue structure with the distribution information of numerous metabolites. Furthermore, the spatially resolved metabolomic analysis of tumor tissue was successfully realized to discover the tumor associated biomarkers. As the key parts of AFA-DESI-MSI system, it has been demonstrated that the designed probs have excellent performance for spatially resolved metabolomics, and it will further promote its application in life science, and drug research and development.
In silico design of anti-tumor mini-protein targeting MDM2
Jinghui Zhang , Huixin Xu , Baishi Wang , Xuekai Zhang , Lei Fu , Yannan Li , Guanzhao Wu , Zitong Zhao , Lu Liu , Ting Yang , Zheyu Zhang , Jinbo Yang , Tao Jiang , Peiju Qiu , Rilei Yu
2023, 34(5): 107871  doi: 10.1016/j.cclet.2022.107871
[Abstract](2418) [FullText HTML] [PDF 2162KB](8)
Abstract:
We designed a disulfide-crosslinked mini-protein with a two-helical topology consisting of L- and D-amino acids, which was exceptionally stable in serum. Therefore, we further used it as a scaffold to design mini-proteins targeting p53 positive tumor cells. Based on bifunctional grafting, key residues from the transactivation domain of p53 and a designed unnatural amino acid were grafted into the helix constituted by L-amino acids to confer the mini-protein with MDM2 inhibitory activity. Meanwhile, ten Arg residues were introduced to improve its membrane penetrating capacity. Among the mini-proteins, UPROL-10e showed nano-molar binding affinity on MDM2 and cellular toxicity on p53 expressing HCT116 cells.
Palladium-catalyzed carbonylative cyclization of alkene-tethered indoles with phenols or arylboronic acids: Construction of carbonyl-containing indolo[2,1-a]isoquinoline derivatives
Siqi Wang , Jian-Shu Wang , Jun Ying , Xiao-Feng Wu
2023, 34(5): 107873  doi: 10.1016/j.cclet.2022.107873
[Abstract](2594) [FullText HTML] [PDF 1032KB](5)
Abstract:
A novel palladium-catalyzed carbonylative cyclization of alkene-tethered indoles with phenols or arylboronic acids is described, which provides a facile approach to access indolo[2,1-a]isoquinoline scaffolds. This method employs benzene-1,3,5-triyl triformate (TFBen) as the CO surrogate for the incorporation of a carbonyl group into indolo[2,1-a]isoquinoline scaffolds, and a variety of carbonyl-containing indolo[2,1-a]isoquinoline derivatives are prepared in good yields.
Activation of hydrogen peroxide by molybdenum disulfide as Fenton-like catalyst and cocatalyst: Phase-dependent catalytic performance and degradation mechanism
Yue Li , Bo Yu , Huimin Li , Bo Liu , Xiang Yu , Kewei Zhang , Gang Qin , Jiahao Lu , Lihui Zhang , Longlu Wang
2023, 34(5): 107874  doi: 10.1016/j.cclet.2022.107874
[Abstract](2707) [FullText HTML] [PDF 3705KB](7)
Abstract:
Molybdenum disulfide (MoS2) has attracted great attention in hydrogen peroxide (H2O2) activation as a Fenton-like catalyst and cocatalyst, but the distinct mechanism of generating OH remains unclear. In this paper, the metallic 1T phase and semiconducting 2H phase of MoS2 nanosheets were prepared and applied in MoS2/H2O2 and MoS2/Fe2+/H2O2 systems with and without light irradiation. Compared with 2H-MoS2, 1T-MoS2 exhibited superior removal rates in degrading organic pollutants in the two systems under light irradiation. However, the phase had little effect on activating H2O2 in the MoS2/H2O2 system under dark conditions. This is because it was difficult for the surface OHads generated in the MoS2/H2O2 system to diffuse into solution, while the OHfree radicals were mainly responsible for degrading organic pollutants. When introducing light irradiation, external energy may accelerate the desorption of OHads into OHfree. Interestingly, the conversion between Mo4+ and Mo5+ triggered the decomposition of H2O2 in the Fenton-like reaction, while the cycle of Mo4+/Mo6+ promoted the regeneration of Fe3+ when employing 1T-MoS2 as a cocatalyst. Meanwhile, the 1T-MoS2 catalysts exhibited excellent stability and ability to degrade various organics in the two systems. This work offers deeper insight into the MoS2-based Fenton-like and cocatalytic mechanisms.
Heterogeneous catalytic ozonation by amorphous boron for degradation of atrazine in water
Zirong Song , Jie Li , Hongxin Xu , Yu Li , Yaxiong Zeng , Baohong Guan
2023, 34(5): 107876  doi: 10.1016/j.cclet.2022.107876
[Abstract](2853) [FullText HTML] [PDF 4677KB](9)
Abstract:
As one of the most promising and practical advanced oxidation processes (AOPs), the catalytic ozonation is triggered by the active components of catalyst, which are usually derived from metals or metal oxides. To avoid the metal pollution from catalyst, here the amorphous boron (A-boron) is used as a metal-free catalyst for catalytic ozonation to produce free radicals for effective degradation of atrazine (ATZ), the world-widely used herbicide and also a widespread pollutant in environment. A-boron exhibits an outstanding performance for catalytic ozonation to remove ATZ from water. As A-boron is introduced into ozonation, the degradation efficiency in 10 min is promoted to 97.1%, much higher than that of 15.1% under ozonation. The mechanism is that the B–B bonds and internal suboxide B in A-boron serve as the main active sites to donate electrons to accelerate ozone decomposition to produce reactive oxygen species (ROS), including O2 and 1O2, and further enhance ATZ degradation via ROS reactions. Moreover, the A-boron is still highly active with a degradation efficiency of ATZ over 95% in 10 min even after four successive cycles. This work shows A-boron could be an alternative for the active components of metal or metal oxide in catalytic ozonation.
Synthesis of stimuli-responsive pillararene-based supramolecular polymer materials for the detection and separation of metal ions
Yongfu Li , Xinyue Lou , Chunyu Wang , Yan Wang , Yu Jia , Qi Lin , Yingwei Yang
2023, 34(5): 107877  doi: 10.1016/j.cclet.2022.107877
[Abstract](3581) [FullText HTML] [PDF 3969KB](4)
Abstract:
A stimuli-responsive supramolecular polymer network (G-(CN)2⊂BXDSP5) with aggregation-induced emission (AIE) properties has been efficiently constructed by host–guest interactions between pillar[5]arene derivative BXDSP5 and a homoditopic guest G-(CN)2, which shows not only excellent fluorescence properties due to the AIE effect but also desirable ion-sensing abilities in both solution and solid states, holding great potential in the applicable fluorescence detection for Fe3+. The resultant G-(CN)2⊂BXDSP5 can be transformed into supramolecular polymer gel at high concentration via multiple noncovalent interactions, showing multi-stimuli-responsiveness in response to temperature change, mechanical force, and competitive agent. Meanwhile, the xerogel of supramolecular polymer material has been successfully used to remove Fe3+ from water with high adsorption efficiency. In addition, an ion-responsive film based on supramolecular polymer has also been developed, which can serve as a practical and convenient fluorescence test kit for detecting Fe3+.
Methylselenized glucose: An efficient organoselenium fertilizer enhancing the selenium content in wheat grains
Limei Xian , Qianru Li , Tao Li , Lei Yu
2023, 34(5): 107878  doi: 10.1016/j.cclet.2022.107878
[Abstract](2772) [FullText HTML] [PDF 1180KB](17)
Abstract:
Selenium (Se) is an essential mineral element for human and other animals, and has been proved to improve plant growth and development and tolerance to different abiotic stresses. Selenium biofortification is considered to be a key strategy to increase the selenium content of edible parts of crops, which is helpful for improving human health. In this work, foliar fertilization with different concentrations and selenium forms was carried out on two wheat varieties at the flowering stage to compare the selenium enrichment effect of Na2SeO3, methylselenized selenocysteine (MSC), methylselenized glucose (MSG) and methylselenized lactide (MSL) in wheat grains. Surprisingly, MSG was found to be the preferable fertilizer. After the application of MSG, the highest selenium content in wheat gains reached 6 mg/kg in this experiment, and the average selenium content was 2–4 times versus that of Na2SeO3 application. Since MSG has high utilization rate and is easily available at relatively low cost, it can be employed as a potential selenium source for selenium biofortification to enhance the added value of agricultural industry.
Control of meta-selectivity in the Ir-catalyzed aromatic C-H borylation directed by hydrogen bond interaction: A combined computational and experimental study
Wenju Chang , Yajun Wang , Yu Chen , Jiawei Ma , Yong Liang
2023, 34(5): 107879  doi: 10.1016/j.cclet.2022.107879
[Abstract](2544) [FullText HTML] [PDF 3555KB](12)
Abstract:
The origin of regioselectivity in meta-selective C-H borylation of benzamides directed by hydrogen bond interaction between ligand and substrate is elucidated through combined computational and experimental studies. We discover that a non-directed pathway, in which the urea moiety in ligand recognizes the O atom in Bpin instead of substrate, competes with the directed pathway and erodes the meta-selectivity. The non-directed pathway is sensitive to steric repulsion between Bpin and urea, and thus can be impeded by introducing a bulky substituent into the urea moiety. Accordingly, we optimize the ligand and improve the meta-selectivity in the Ir-catalyzed C-H borylation of some previously reported unsuccessful arenes.
Sequentially responsive size reduction and drug release of core-satellite nanoparticles to enhance tumor penetration and effective tumor suppression
Jiayi Sun , Jingyang Li , Xi Li , Lu Yang , Yitong Liu , Huile Gao , Li Xiang
2023, 34(5): 107891  doi: 10.1016/j.cclet.2022.107891
[Abstract](2614) [FullText HTML] [PDF 2964KB](6)
Abstract:
Poor tumor accumulation remains a serious challenge for nanomedicines to achieve ideal antitumor outcomes. The different size preferences for systematic circulation, tumor retention and deep permeation have attracted great attention when designing antineoplastic nano-delivery system. Herein, we developed a nano-system which can shrink its size in tumor microenvironment to achieve better tumor retention and penetration. In this work, the cationic bovine serum albumin-protected, doxorubicin-loaded gold nanoclusters (CAuNC-DOX) and amino-functionalized mesoporous silica nanoparticles (MSN) are connected by Fe2+ and are further coated with hyaluronic acid (HA) to obtain a core-satellite MSN-Fe-CAuNC-DOX@HA nano system (MFADH). When reaching the tumor site, the HA shell, which endows the system with both good biocompatibility and preferable tumor targeting ability, was disintegrated, followed by acid-stimulated release of small-sized pharmacological unit—CAuNC-DOX for further tumor penetration. As demonstrated in both in vitro and in vivo results, MFADH showed excellent antitumor effect, providing a proof of concept for the feasibility of shrinkable nanoplatforms in tumor treatment.
Phosphine oxide directing-group-enabled atroposelective C–H bond acyloxylation via an eight-membered palladacycle intermediate
Peng-Bo Bai , Ming-Ying Wu , Xin-Xin Yang , Gang-Wei Wang , Shang-Dong Yang
2023, 34(5): 107894  doi: 10.1016/j.cclet.2022.107894
[Abstract](2586) [FullText HTML] [PDF 1249KB](6)
Abstract:
Herein, we report the first atroposelective C(sp2)–H bond acyloxylation enabled by a phosphine oxide directing group. Uniquely, this transformation is shown to proceed through an eight-membered palladacycle intermediate, as opposed to the kinetically and thermodynamically favored five-membered palladacycle intermediate. Additionally, L-pGlu-OH, a cheap and abundant chiral amino acid derivative, was identified as the best chiral ligand to promote this atroposelective remote CH functionalization reaction.
Efficient synthesis of cyclic imides by the tandem N-arylation-acylation and rearrangement reaction of cyanoesters with diaryliodonium salts
Zhiyuan Bao , Chao Chen
2023, 34(5): 107913  doi: 10.1016/j.cclet.2022.107913
[Abstract](2704) [FullText HTML] [PDF 5302KB](5)
Abstract:
Available online An efficient method for the synthesis of multi-substituted cyclic imides was developed with cyanoesters and diaryliodonium salts. This method proceeds through a cascade of N-arylation-acylation and rearrangement to give target heterocycles in good yields (up to 99%). This method has the major advantages of a broad substrate scope, excellent functional group compatibility. The strategy was also extended to the fused cyclic imides, such as malonimides, succinimides and glutarimides.
Surface modification of Li3InCl6 provides superior electrochemical performance for LiMn2O4 cathode materials
Yixun Gu , Kuan Yang , Hongbin Yao , Weijian Li , Haiqing Zhan , Xianquan Ming , Guanhan Huang , Guiliang Li , Feng Zhan
2023, 34(5): 108047  doi: 10.1016/j.cclet.2022.108047
[Abstract](2876) [FullText HTML] [PDF 3072KB](5)
Abstract:
LiMn2O4 (LMO) is the substance of choice for small and medium-sized energy storage materials in daily life. In this work, Li3InCl6 (LIC) is prepared on the surface of LiMn2O4 by hydrothermal method using InCl3 and LiCl as raw materials. This method stabilizes the LMO crystal structure by uniformly coating the LIC on the LMO surface and effectively maintains the morphology of LMO crystals during the cycling process. SEM and EDS analysis confirm the morphology and homogeneity of the synthesized material LIC on the LMO surface. The prepared material is put into a battery, and the charge-discharge test is carried out at 0.5 C and 1 C. The results show that the LIC surface-modified samples exhibit more than 6% higher cycling performance than the unmodified samples after long cycling.
Lanthanide coordinated multicolor fluorescent polymeric hydrogels for bio-inspired shape/color switchable actuation through local diffusion of Tb3+/Eu3+ ions
Ruijia Wang , Wei Lu , Yi Zhang , Wanning Li , Wenqin Wang , Tao Chen
2023, 34(5): 108086  doi: 10.1016/j.cclet.2022.108086
[Abstract](2684) [FullText HTML] [PDF 3350KB](3)
Abstract:
Lanthanide coordinated multicolor fluorescent polymeric hydrogels (MFPHs) are quite promising for various applications because of their sharp fluorescence bands and high color purity. However, few attempts have been carried out to locally regulate their fluorescence switching or shape deforming behaviors, but such studies are very useful for patterned materials with disparate functions. Herein, the picolinate moieties that can sensitize Tb3+/Eu3+ luminescence via antenna effect were chemically introduced into interpenetrating double networks to produce a robust kind of lanthanide coordinated MFPHs. Upon varying the doping ratio of Tb3+/Eu3+, fluorescence colors of the obtained hydrogels were continuously regulated from green to orange and then red. Importantly, spatial fluorescence color control within the hydrogel matrix could be facilely realized by controlled diffusion of Tb3+/Eu3+ ions, producing a number of 2D hydrogel objects with local multicolor fluorescent patterns. Furthermore, the differential swelling capacities between the fluorescent patterned and non-fluorescent parts led to interesting 2D-to-3D shape deformation to give well-defined multicolor fluorescent 3D hydrogel configurations. Based on these results, bio-inspired synergistic color/shape changeable actuators were demonstrated. The present study provided a promising strategy to achieve the local fluorescence and shape control within lanthanide coordinated hydrogels, and is expected to be expanded for fabricating useful patterned materials with disparate functions.
A mild phenoxysilyl linker for self-immolative release of antibody-drug conjugates
Ding Wei , Yurong Mao , Huihui Wang , Siqi Qu , Jiakang Chen , Jiusheng Li , Biao Jiang , Hongli Chen
2023, 34(5): 108091  doi: 10.1016/j.cclet.2022.108091
[Abstract](3101) [FullText HTML] [PDF 4154KB](34)
Abstract:
Self-immolative linkers have been widely used to construct prodrugs to improve their efficacy and safety. In this study, we report the use of phenoxysilyl linker as a self-immolative unit to prepare antibody-drug conjugates (ADCs). Phenoxysily based ADC Ate-PPS-CA4 was prepared and its release was systematically investigated by mass spectrometry. Biological evaluation showed that Ate-PPS-CA4 displayed the ability to target delivery and self-immolative release the active payload CA4 on PD-L1 positive cells MDA-MB-231. As the same with its payload CA4, it could arrest the cell cycle to the G2/M phase and induced changes in cell morphology at the dose of its IC50. The development of this linker with novel drug release mechanisms will expand the methodology to construct ADCs, especially for non-internalizing ADCs by extracellular cleavage.
Indocyanine green-/TLR7 agonist-constructed thermosensitive liposome for low-temperature PTT induced synergistic immunotherapy of colorectal cancer
Xiang Sun , Yanmin Wang , Tao Du , Qiang Zhang , Shuo Li , Qinda Chen , Miao Wang , Xiumin Wang , Lei Ren , Xueqin Zhao
2023, 34(5): 108201  doi: 10.1016/j.cclet.2023.108201
[Abstract](3121) [FullText HTML] [PDF 5419KB](7)
Abstract:
Colorectal cancer (CRC) is a lethal malignancy with a high mortality rate due to its low immunogenicity, the strong immunosuppressive milieu and poor drug permeability. To overcome these obstacles, a cascade synergistic nanosystem (denoted as R837/ICG@Lip) was developed via self-assembly of heater indocyanine green (ICG) and toll-like receptor-7 agonist imiquimod (R837) into thermosensitive liposome for simultaneous induction of immunogenic cell death (ICD) and reversing of suppressive tumor microenvironment. The obtained nanoparticles exhibited NIR-triggered drug release, good photothermal conversion efficiency and phototoxicity towards CT26 colorectal cancer cells. In vivo results reveal that the R837/ICG@Lip could be effectively accumulated in CT26 subcutaneous tumors and the draining lymph nodes. More importantly, R837/ICG@Lip-mediated low-temperature photothermal therapy triggers ICD, promotes the maturation of host dendritic cells (DCs), and subsequently amplifies adaptive antitumor T-cell responses, resulting in 'Cold to Hot' transition. Besides directly affecting immune cells, the secretion of some immune-related cytokines further indirectly boosted anti-cancer immunity. After combining with the indoleamine 2, 3-dioxygenase (IDO) inhibitor, the systemic antitumor immune response was further augmented, achieving best tumor inhibition effects. Thus, low-temperature mediated photoimmunotherapy targeting multiple antitumor immune pathways boost synergistic antitumor immunity of tolerance tumors.
A fluorogenic probe for SNAP-tag protein based on ESPT ratiometric signals
Jin Li , Qinglong Qiao , Yiyan Ruan , Ning Xu , Wei Zhou , Guixin Zhang , Jingli Yuan , Zhaochao Xu
2023, 34(5): 108266  doi: 10.1016/j.cclet.2023.108266
[Abstract](2383) [FullText HTML] [PDF 7442KB](4)
Abstract:
Protein self-labeling tags achieve selective fusion and labeling of target proteins through genetic coding technology, but require exogenous fluorescent probes with fluorogenicity for protein tag binding to have the performance of wash-free fluorescence imaging in live cells. In this paper, we reported a fluorogenic probe 1 capable of ratiometric fluorescence recognition of SNAP-tag proteins. In this probe, the O6-benzylguanine derivative of 3–hydroxy-1,8-naphthalimide underwent a selective covalent linkage reaction with SNAP-tag protein. The hydroxyl group on the naphthalimide fluorophore formed a hydrogen bond with the functional group near the protein cavity. The excited state proton transfer occurred after illumination, to obtain the ratio fluorescence signal from blue emission to red emission, realizing the wash-free fluorescence imaging of the target proteins.
Key progresses of MOE key laboratory of macromolecular synthesis and functionalization in 2021
Quan Wen , Qiuquan Cai , Ping Fu , Dan Chang , Xiaoyi Xu , Tian-Jiao Wen , Guang-Peng Wu , Weipu Zhu , Ling-Shu Wan , Chengjian Zhang , Xing-Hong Zhang , Qiao Jin , Zi-Liang Wu , Chao Gao , Haoke Zhang , Ning Huang , Chang-Zhi Li , Hanying Li
2023, 34(5): 107592  doi: 10.1016/j.cclet.2022.06.015
[Abstract](3907) [FullText HTML] [PDF 15127KB](11)
Abstract:
In 2021, The MOE Key Laboratory of Macromolecular Synthesis and Functionalization in Zhejiang University had achieved several important results. First, a series of versatile organoboron catalysts were synthesized for ring-opening (co)polymerizations. Second, a catalyst-free polycondensation mechanism was proposed for the production of polyesters with high molecular weights. Third, a co-assembly method that can fabricate films and coatings with controllable structures and properties on various substrates was demonstrated, providing a platform for the construction of novel surface coatings. Forth, facile methods for producing high-productivity poly(propylene carbonate) and semicrystalline polyester have been discovered. And linear non-conjugated polyesters exhibiting yellow-green clusteroluminescence were developed for the first time. Fifth, a supramolecular prodrug nano-assembly strategy has been developed for reactive nitrogen species potentiated chemotherapy. Sixth, a series of tough and stiff supramolecular hydrogels with shape memory properties have been used for information encryption. Seventh, reversible fusion and fission of wet-spun graphene oxide fibers has been successfully achieved. Eighth, three non-conjugated polypeptides were synthesized and the mechanism of clusteroluminescence was studied. Ninth, a series of conducting covalent organic frameworks with high electrical conductivity and carrier mobility have been used as high-performance chemiresistor, electrocatalyst, and organic field-effect transistor. Tenth, the exploration of non-fused electron acceptors, and their photostable mechanism are exemplified for developing high-performance, low-cost and eco-friendly polymer solar cells. Finally, gel-grown long-range ordering bulk-heterojunctions has achieved improved X-ray detector performance.
Recent advances for Zn-gas batteries beyond Zn-air/oxygen battery
Rong Zhang , Zhuoxi Wu , Zhaodong Huang , Ying Guo , Shaoce Zhang , Yuwei Zhao , Chunyi Zhi
2023, 34(5): 107600  doi: 10.1016/j.cclet.2022.06.023
[Abstract](3546) [FullText HTML] [PDF 10940KB](4)
Abstract:
Zn-gas batteries have attracted great attention in the area of energy conversion and storage owing to their high theoretical energy density in the past decades. In addition to the most widely researched Zn-air/oxygen battery, other novel Zn-gas batteries such as Zn-CO2, Zn-N2 and Zn-NO batteries as "killing two birds with one stone" strategy have emerged to provide energy power and upgrade the pollutant/useless gases simultaneously. This technology becomes more appealing as a low-cost and controllable method to produce value-added chemicals and fuels (such as CO, HCOO, CH4, NH3) at the cathode driven by surplus electricity. However, there is an absence of a guide for the selection of catalyst and the construction of energy system. Herein, we overview recent achievements in typical Zn-gas batteries beyond Zn-air/oxygen, mainly including Zn-CO2, Zn-N2 and Zn-NO batteries. The energy storage mechanism of these novel Zn-gas batteries has been clearly elaborated. Then, the produced value-added chemicals and the design of cathodic catalyst materials are summarized. Lastly, the remaining challenges and possible directions of Zn-gas batteries, such as highly reduced products, high yield rate and remarkable battery performance, in the future are discussed.
Responsive switchable deep eutectic solvents: A review
Jingyu Zhang , Shang Li , Liping Yao , Yuexing Yi , Lingqi Shen , Zuguang Li , Hongdeng Qiu
2023, 34(5): 107750  doi: 10.1016/j.cclet.2022.107750
[Abstract](3480) [FullText HTML] [PDF 5664KB](44)
Abstract:
Deep eutectic solvents (DESs) have drawn considerable attention as a new type of green solvent since they were reported. Subsequent studies have shown that DESs have the potential to be used as "designable" solvents, which means that the precursors of DESs with different structures and properties can be screened to customize DESs for specific functions. Researchers have found that during the sample preparation process involving DESs, the specific properties of some "smart" DESs can be switched by directing external driving forces, leading to a reversible phase transition of the target solution. These "smart" DESs are called switchable deep eutectic solvents (SDESs). The advent of SDES simplifies the sample pretreatment steps, reduces the use of organic solvents, and makes solvents easy to recycle, which matches the concept of green and sustainable chemistry. Compared with the number of previous experimental studies, the reviews and summaries on SDESs are rare. Therefore, this review made a summary of the concept and research progress of SDESs based on some related works in the past decade, including composition and type, characterization, switching mechanism, etc. It is expected to provide a certain reference and guidance for the subsequent in-depth research of SDESs in the analytical sample pretreatment.
A chronological review of photochemical reactions of ferrioxalate at the molecular level: New insights into an old story
Xiaodie Li , Meiru Hou , Yu Fu , Lingli Wang , Yifan Wang , Dagang Lin , Qingchao Li , Dongdong Hu , Zhaohui Wang
2023, 34(5): 107752  doi: 10.1016/j.cclet.2022.107752
[Abstract](4477) [FullText HTML] [PDF 2522KB](18)
Abstract:
Owing to its outstanding photoactivity, ferrioxalate is originally used as an actinometer and subsequent work has discovered that photochemistry of ferrioxalate is also fundamentally or technically important in atmospheric chemistry and water treatment. While the overall products generated from photolysis of ferrioxalate are known to include Fe(Ⅱ), a series of oxidizing (e.g., OH, O2•−/HO2•−) or reducing (C2O4•−/CO2•−) radicals and H2O2, however, at the molecular level, the primary step of the photoreaction of ferrioxalate remains as an unsolved mystery due to the difficulty in examining such ultrafast processes. Benefiting from the development of time-resolved spectroscopy, this old question has been studied with increasing vigor recently, by means of such ever-more-sophisticated techniques (e.g., flash photolysis, time-resolved X-ray absorption spectroscopy (XAS), femtosecond infrared (IR) absorption spectroscopy, ultrafast photoelectron spectroscopy (PES)). There are two contrary views on the primary reaction mechanism: (1) Intramolecular electron transfer (ET) precedes the cleavage of the metal-ligand bond; (2) The dissociation of C–C or Fe–O bond occurs before intramolecular ET. Thus, this review presents a comprehensive summary about the overall reaction mechanism and molecular level mechanism of ferrioxalates. In chronological order, we have elaborated two predominant but controversial views from the perspectives of different experimental approaches. Some challenges and research opportunities in this active field are also briefly discussed.
Recent advances in chemical fixation of CO2 based on flow chemistry
Hui Luo , Jing Ren , Ying Sun , Yunlin Liu , Feng Zhou , Guoyue Shi , Jian Zhou
2023, 34(5): 107782  doi: 10.1016/j.cclet.2022.107782
[Abstract](3534) [FullText HTML] [PDF 6739KB](11)
Abstract:
Carbon dioxide (CO2) is an attractive C1 building block in chemical synthesis due to its abundance, availability and sustainability. However, the low reactivity and high stability generally limits its transformations under mild conditions to value added chemicals. Recent advances in flow chemistry provide effective means for the chemical transformation of CO2, and many new methods and techniques that fully utilized the advantages of continuous flow platforms for the chemical fixation of CO2 have been realized. In view of the rapid development and the urgent need for continuous transformation of CO2, herein we wish to present an update of the recent advances in this research area.
Design of portable electrochemiluminescence sensing systems for point-of-care-testing applications
Shuqi Xia , Jiangfei Pan , Deshen Dai , Zong Dai , Mengsu Yang , Changqing Yi
2023, 34(5): 107799  doi: 10.1016/j.cclet.2022.107799
[Abstract](4009) [FullText HTML] [PDF 13713KB](16)
Abstract:
Point-of-care testing (POCT) technology is highly desirable for clinical diagnosis, healthcare monitoring, food safety inspection, and environment surveillance, because it enables rapid detection anywhere, anytime, and by anyone. Electrochemiluminescence (ECL) has been widely used in chemo-/bio analysis due to its advantages such as high sensitivity, simplicity, rapidity and easy to control, and is now attracting increasing attention for POCT applications. However, to realize the accurate on-site quantitation, it is still challenging to develop portable devices which can precisely collect, analyze, transmit and display the ECL signals. This review will focus on how to develop a portable ECL device by summarizing recent examples and analyzing their key components part by part. Then the possible solutions to the existing challenges in the development and applications of portable ECL devices are summarized and discussed in detail, followed by offering future perspectives. We attempted to provide an appealing viewpoint to inspire interested researchers to comprehend and explore portable ECL sensing systems for practical applications and even commercialization.
Mitochondria-targeted cancer therapy based on functional peptides
Yuhan Sun , He Zhang , Guangzhao Lu , Huan Wang , Ying Lu , Li Fan
2023, 34(5): 107817  doi: 10.1016/j.cclet.2022.107817
[Abstract](3834) [FullText HTML] [PDF 2492KB](19)
Abstract:
Mitochondria are critical for tumor growth and metastasis. A number of traditional antitumor drugs have poor water solubility and must penetrate multiple cellular barriers to reach the mitochondria. Because mitochondria have a unique transmembrane potential and an inner membrane with a low permeability, it is difficult for most drugs to enter mitochondria. In recent years, mitochondria-targeted delivery systems that use functional peptides to modify drugs have received increasing attention. Introducing functional peptides can change the original physicochemical properties of drugs and actively target mitochondria. Functional peptide-drug conjugates (PDCs, peptide-drug conjugates) can decompose and release drugs over time or due to certain stimuli in tumors. This preserves the biological activity of the drug while increasing intratumor uptake through the enhanced permeability and retention effect (EPR, the enhanced permeability and retention effect). In this review, we focus on the direction of cancer therapy and review the application of different functional peptides in the mitochondria-targeted tumor treatments reported in recent years.
3D skin models along with skin-on-a-chip systems: A critical review
Wenxuan Sun , Zijia Liu , Jian Xu , Ya Cheng , Ruixue Yin , Lei Ma , Honglin Li , Xuhong Qian , Hongbo Zhang
2023, 34(5): 107819  doi: 10.1016/j.cclet.2022.107819
[Abstract](4059) [FullText HTML] [PDF 1065KB](53)
Abstract:
Skin is the largest organ in human body, and it plays an important role in regulating physiological microenvironments and acts as a barrier to protect human body from harmful intrusions. The demand for fully functional skin models (also called skin equivalents, SE) in an in-vivo mimicking culturing microenvironment has been increased dramatically due to the fast development in skin disease treatments and skin care products. Owing to the emerging of the concept and technology of organ-on-chips along with the three-dimensional (3D) bioprinting technology, 3D skin models and their applications have been fast evolving. In this paper, the advances in the development of 3D skin models along with skin-on-a-chip (SOC) are reviewed and commented. One of the findings with this paper is that the SOC together with the 3D bioprinting technology is promising to construct fully functional 3D skin models in the field of pharmaceutical and cosmetic industries.
Modification and application of Fe3O4 nanozymes in analytical chemistry: A review
Jiahe Ju , Yitong Chen , Zhiqiang Liu , Cheng Huang , Yaqi Li , Dezhao Kong , Wei Shen , Sheng Tang
2023, 34(5): 107820  doi: 10.1016/j.cclet.2022.107820
[Abstract](4863) [FullText HTML] [PDF 4211KB](52)
Abstract:
In recent years, Fe3O4 nanomaterials have received much attention in analytical chemistry due to their excellent magnetic and peroxidase-like activity. As the catalytic characteristics of Fe3O4 nanomaterials is similar to those of horseradish peroxidase (HRP), Fe3O4 nanomaterials are also used as peroxidase mimics and have achieved a certain development in many fields based on latest research results. To improve the stability and catalytic ability of simple Fe3O4 nanomaterials, various modification strategies of Fe3O4 nanomaterials have been developed. The recent advances of these strategies have been presented and discussed. In addition, this paper introduces the application of Fe3O4 nanozymes in the detection of food and industrial pollutants, as well as in the field of biosafety.
Carrier-free supramolecular nanomedicines assembled by small-molecule therapeutics for cancer treatment
Jianhui Zuo , Xin Gao , Jianru Xiao , Yiyun Cheng
2023, 34(5): 107827  doi: 10.1016/j.cclet.2022.107827
[Abstract](3137) [FullText HTML] [PDF 10790KB](12)
Abstract:
Nanomedicines have shown great promise in cancer therapy, but are challenged by limited drug loading, safety concerns of drug carriers, and complexity of function integration. Recently, carrier-free nanomedicines produced by supramolecular assembly of small-molecule therapeutic functionalities and their conjugates were proposed to address these issues. These nanomedicines achieve very high drug loading, enhanced tumor accumulation and improved therapeutic efficiency, and avoid carrier-related safety problems. In this review article, the applications of these nanomedicines in chemotherapy, photodynamic therapy, photothermal therapy as well as combination therapies will be reviewed. The concept of nanomedicine design and mechanism of supramolecular assembly will be discussed. Finally, future perspectives of carrier-free supramolecular nanomedicines for cancer therapy will be highlighted.
Bioremediation strategies of palm oil mill effluent and landfill leachate using microalgae cultivation: An approach contributing towards environmental sustainability
Imran Ahmad , Natasha Nabila Binti Ibrahim , Norhayati Abdullah , Iwamoto Koji , Shaza Eva Mohamad , Kuan Shiong Khoo , Wai Yan Cheah , Tau Chuan Ling , Pau Loke Show
2023, 34(5): 107854  doi: 10.1016/j.cclet.2022.107854
[Abstract](3396) [FullText HTML] [PDF 3721KB](18)
Abstract:
Palm oil mill effluent (POME) is defined as the wastewater that contains high concentrations of organics, nutrients and oil and grease generated from the production process of palm oil. Therefore, proper discharge and management of POME is important to avoid deleterious impact on the environment. In fact, solid waste generation is a precursor for its disposal issues as most of the solid waste generated in developing nations is dumped into landfills. This has led to the threat posed by the generation of landfill leachate (LL). LL is a complex dark coloured liquid consisting of organic matter, inorganic substances, trace elements and xenobiotics. Hence, it is essential to effectively treat the landfill leachate before discharging it to avoid contamination of soil, surface & groundwater bodies. Conventional treatment methods comprises of physical, biological and chemical treatment, however, microalgal-based treatment could also be incorporated. Furthermore, with the benefits offered by microalgae in valorisation, the application of microalgae in POME and leachate treatment as well as biofuel production, is considerably viable. This paper provides an acumen of the microalgae-based treatment of POME and LL, integrated with biofuel production in a systematic and critical manner. The pollutants assimilation from wastewater and CO2 biosequestration are discussed for environmental protection. Cultivation systems for wastewater treatment with simultaneous biomass production and its valorisation, are summarised. The study aims to provide insight to industrial stakeholders on economically viable and environmentally sustainable treatment of wastewaters using microalgae, and eventually contributing to the circular bioeconomy and environmental sustainability.
Advanced municipal wastewater treatment and simultaneous energy/resource recovery via photo(electro)catalysis
Dengke Wang , Siqi Chen , Shiqin Lai , Weili Dai , Lixia Yang , Lanqing Deng , Mengjuan Suo , Xuyang Wang , Jian-Ping Zou , Sheng-Lian Luo
2023, 34(5): 107861  doi: 10.1016/j.cclet.2022.107861
[Abstract](3314) [FullText HTML] [PDF 11563KB](15)
Abstract:
Wastewater management and energy/resource recycling have been extensively investigated via photo(electro)catalysis. Although both operation processes are driven effectively by the same interfacial charge, each system is practiced separately since they require very different reaction conditions. In this review, we showcase the recent advancements in photo(electro)catalytic process that enables the wastewater treatment and simultaneous energy/resource recovery (WT-ERR). Various literatures based on photo(electro)catalysis for wastewater treatment coupled with CO2 conversion, H2 production and heavy metal recovery are summarized. Besides, the fundamentals of photo(electro)catalysis and the influencing factors in such synergistic process are also presented. The essential feature of the catalysis lies in effectively utilizing hole oxidation for pollutant degradation and electron reduction for energy/resource recovery. Although in its infancy, the reviewed technology provides new avenue for developing next-generation wastewater treatment process. Moreover, we expect that this review can stimulate intensive researches to rationally design photo(electro)catalytic systems for environmental remediation accompanied with energy and resource recovery.
Clusteroluminescence: A gauge of molecular interaction
Bin Liu , Bo Chu , Lixun Zhu , Haoke Zhang , Wang-Zhang Yuan , Zheng Zhao , Wen-Ming Wan , Xing-Hong Zhang
2023, 34(5): 107909  doi: 10.1016/j.cclet.2022.107909
[Abstract](3439) [FullText HTML] [PDF 6252KB](10)
Abstract:
Clusteroluminescence (CL) materials, as an emerging class of luminescent materials with unique photophysical properties, have received increasing attention owing to their great theoretical significance and potential for biological applications. Although much progress has been made in the design, synthesis and application of CL materials, there is still a big challenge in the emission mechanism. So far, through-space interaction has been proposed as the preliminary mechanism of the corresponding clusterization-triggered emission (CTE) effect, but a systematic theory is still needed. This review summarizes the current mechanistic understanding of CL materials including organic/inorganic small molecules, and polymers with/without isolated aromatic structures. In addition, some strategies to achieve high quantum yield, adjustable emission color, and persistent room temperature phosphorescence in CL materials are also summarized. At last, a perspective of the mechanism and application of CL materials are demonstrated, which inspire the researchers working on the development of new kinds of functional materials.
Treatment of Alzheimer's disease with small-molecule photosensitizers
Yefei Jiang , Zhiyong Zeng , Jianhua Yao , Ying Guan , Peipei Jia , Xiaoli Zhao , Lin Xu
2023, 34(5): 107966  doi: 10.1016/j.cclet.2022.107966
[Abstract](2945) [FullText HTML] [PDF 10302KB](10)
Abstract:
Alzheimer's disease is a neurodegenerative disease that signals for excess β-amyloid (Aβ) aggregation. Although people have made great attempts to control the aggregation of Aβ, no effective medications have been produced yet. Due to its excellent temporal and spatial selectivity, photodynamic treatment has been gradually employed and interfered in the aggregation process of Aβ, with some achievement. To enhance the research and application of photodynamic therapy in Alzheimer's disease, this paper reviews the progress of small-molecule photosensitizers in the treatment of Alzheimer's disease in recent years and outlines existing tactics and potential obstacles.
Advances in component and operation optimization of solid oxide electrolysis cell
Xiaoxin Zhang , Bo Liu , Yanling Yang , Jianhui Li , Jian Li , Yingru Zhao , Lichao Jia , Yifei Sun
2023, 34(5): 108035  doi: 10.1016/j.cclet.2022.108035
[Abstract](3914) [FullText HTML] [PDF 4783KB](20)
Abstract:
Considering the earth powered by intermittent renewable energy in the coming future, solid oxide electrolysis cell (SOEC) will play an indispensable role in efficient energy conversion and storage on demand. The thermolytic and kinetic merits grant SOEC a bright potential to be directly integrated with electrical grid and downstream chemical synthesis process. Meanwhile, the scientific community are still endeavoring to pursue the SOEC assembled with better materials and operated at a more energy-efficient way. In this review article, at cell level, we focus on the recent development of electrolyte, cathode, anode and buffer layer materials for both steam and CO2 electrolysis. On the other hand, we also discuss the next generation SOEC operated with the assistant of other fuels to further reduce the energy consumption and enhance the productivity of the electrolyzer. And stack level, the sealant, interconnect and stack operation strategies are collectively covered. Finally, the challenges and future research direction in SOECs are included.
Trifluoromethoxylation/trifluoromethylthiolation/trifluoro-methylselenolation strategy for the construction of heterocycles
Xin Wang , Zhichuan Wang , Zhenjian Li , Kai Sun
2023, 34(5): 108045  doi: 10.1016/j.cclet.2022.108045
[Abstract](2537) [FullText HTML] [PDF 3127KB](13)
Abstract:
The XCF3 groups (X = O, S, Se) play an increasingly important role in modern organic chemistry due to their unique electronegativity, lipophilic nature, metabolic stability, and bioavailability. Heterocyclic compounds are important scaffolds in many bioactive compounds and drugs. The incorporation of XCF3 groups into heterocyclic compounds can change their physicochemical and biological properties, which injects new vitality into the application of heterocyclic compounds in many fields such as organic chemistry, the pharmaceutical chemistry, and life sciences. In this paper, the recent progress in the synthesis of F3CX-containing heterocycles is reviewed, and the application scope and mechanism of some reactions are discussed.
Recent advances in polyoxometalates acid-catalyzed organic reactions
Yu-Feng Liu , Chang-Wen Hu , Guo-Ping Yang
2023, 34(5): 108097  doi: 10.1016/j.cclet.2022.108097
[Abstract](2963) [FullText HTML] [PDF 3248KB](29)
Abstract:
Polyoxometalates (POMs) have conducive properties such as controlled Brønsted and Lewis acidity, high thermal stability, nontoxic nature, tunable solubility, and less corrosiveness. POMs have been extensively applied in catalytic organic reactions and have an exciting prospect for industrial applications. This review summarized recent progress in the application of POMs as acid catalysts for various organic reactions including CC bond formation, CN bond formation, CO bond formation, heterocyclic synthesis reactions, cyanosilylation and hydrolysis reactions. Various POMs catalysts including heteropoly acids (HPAs) and cationic functionalized HPAs with Brønsted acidity, HPAs supported on non-precious metal support with Brønsted acidity (or both Brønsted and Lewis acidity), transition metal substituted POMs with Lewis acidity were applied in above reactions. This review attempts to provide up-to-date information about POMs acid-catalyzed organic reactions and propose future prospects.
Preorganized cationic pillararene as efficient carriers for intracellularly delivering native proteins
Hong-Mei Yu , Xiao-Yong Yu , Yong Chen
2023, 34(5): 108037  doi: 10.1016/j.cclet.2022.108037
[Abstract](3122) [FullText HTML] [PDF 1824KB](7)
Abstract:
Address:Zhongguancun North First Street 2,100190 Beijing, PR China Tel: +86-010-82449177-888
Powered By info@rhhz.net